ID: 961495397

View in Genome Browser
Species Human (GRCh38)
Location 3:127287729-127287751
Sequence GAGAAAAAAGATGGAGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495387_961495397 11 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495392_961495397 -10 Left 961495392 3:127287716-127287738 CCTTAGCGGAAGAGAGAAAAAAG No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495384_961495397 26 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495390_961495397 -6 Left 961495390 3:127287712-127287734 CCCTCCTTAGCGGAAGAGAGAAA No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495388_961495397 8 Left 961495388 3:127287698-127287720 CCTGGAGGAATGATCCCTCCTTA No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495391_961495397 -7 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495397 Original CRISPR GAGAAAAAAGATGGAGGATG GGG Intergenic
No off target data available for this crispr