ID: 961500172

View in Genome Browser
Species Human (GRCh38)
Location 3:127326769-127326791
Sequence CTGGACATAGACTCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961500172_961500174 -3 Left 961500172 3:127326769-127326791 CCTTCAAAGGAGTCTATGTCCAG No data
Right 961500174 3:127326789-127326811 CAGTTCCAGTCCTATTGCCCTGG No data
961500172_961500175 -2 Left 961500172 3:127326769-127326791 CCTTCAAAGGAGTCTATGTCCAG No data
Right 961500175 3:127326790-127326812 AGTTCCAGTCCTATTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961500172 Original CRISPR CTGGACATAGACTCCTTTGA AGG (reversed) Intergenic
No off target data available for this crispr