ID: 961503235

View in Genome Browser
Species Human (GRCh38)
Location 3:127352117-127352139
Sequence TTGTGGGAGTGGCAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961503226_961503235 13 Left 961503226 3:127352081-127352103 CCATGTAGCATCACTCTGCCACC No data
Right 961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG No data
961503224_961503235 19 Left 961503224 3:127352075-127352097 CCCGCACCATGTAGCATCACTCT No data
Right 961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG No data
961503223_961503235 25 Left 961503223 3:127352069-127352091 CCTGGTCCCGCACCATGTAGCAT No data
Right 961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG No data
961503225_961503235 18 Left 961503225 3:127352076-127352098 CCGCACCATGTAGCATCACTCTG No data
Right 961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG No data
961503228_961503235 -5 Left 961503228 3:127352099-127352121 CCACCTGCTACAGGTTACTTGTG No data
Right 961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG No data
961503231_961503235 -8 Left 961503231 3:127352102-127352124 CCTGCTACAGGTTACTTGTGGGA No data
Right 961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961503235 Original CRISPR TTGTGGGAGTGGCAAGAGGA GGG Intergenic
No off target data available for this crispr