ID: 961506945

View in Genome Browser
Species Human (GRCh38)
Location 3:127376283-127376305
Sequence CACAAGAGAGTTCCTGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961506941_961506945 4 Left 961506941 3:127376256-127376278 CCAGCCTCTTCTGCAACTGGATG No data
Right 961506945 3:127376283-127376305 CACAAGAGAGTTCCTGCCAATGG No data
961506943_961506945 0 Left 961506943 3:127376260-127376282 CCTCTTCTGCAACTGGATGTGGC No data
Right 961506945 3:127376283-127376305 CACAAGAGAGTTCCTGCCAATGG No data
961506940_961506945 5 Left 961506940 3:127376255-127376277 CCCAGCCTCTTCTGCAACTGGAT No data
Right 961506945 3:127376283-127376305 CACAAGAGAGTTCCTGCCAATGG No data
961506938_961506945 20 Left 961506938 3:127376240-127376262 CCATGGTGCACACTTCCCAGCCT No data
Right 961506945 3:127376283-127376305 CACAAGAGAGTTCCTGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961506945 Original CRISPR CACAAGAGAGTTCCTGCCAA TGG Intergenic
No off target data available for this crispr