ID: 961509633

View in Genome Browser
Species Human (GRCh38)
Location 3:127392919-127392941
Sequence AGTCAGCCCCAGCCATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961509633_961509637 -2 Left 961509633 3:127392919-127392941 CCTGGGCATGGCTGGGGCTGACT No data
Right 961509637 3:127392940-127392962 CTCTGTGCTGGCCACTCCTGGGG No data
961509633_961509636 -3 Left 961509633 3:127392919-127392941 CCTGGGCATGGCTGGGGCTGACT No data
Right 961509636 3:127392939-127392961 ACTCTGTGCTGGCCACTCCTGGG No data
961509633_961509635 -4 Left 961509633 3:127392919-127392941 CCTGGGCATGGCTGGGGCTGACT No data
Right 961509635 3:127392938-127392960 GACTCTGTGCTGGCCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961509633 Original CRISPR AGTCAGCCCCAGCCATGCCC AGG (reversed) Intergenic