ID: 961512560

View in Genome Browser
Species Human (GRCh38)
Location 3:127412033-127412055
Sequence CAGCCCTAACAGCCCTAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961512554_961512560 -6 Left 961512554 3:127412016-127412038 CCTGCATGTCCCACCTCCAGCCC 0: 151
1: 273
2: 147
3: 163
4: 1139
Right 961512560 3:127412033-127412055 CAGCCCTAACAGCCCTAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961512560 Original CRISPR CAGCCCTAACAGCCCTAAGG CGG Intergenic
No off target data available for this crispr