ID: 961513906

View in Genome Browser
Species Human (GRCh38)
Location 3:127421027-127421049
Sequence CAGGGTGAGTACTCTGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961513906_961513920 28 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513920 3:127421078-127421100 CTCACACAGGGGCTGATCCCAGG No data
961513906_961513917 17 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513917 3:127421067-127421089 AGAGCCCTGGGCTCACACAGGGG No data
961513906_961513921 29 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513921 3:127421079-127421101 TCACACAGGGGCTGATCCCAGGG No data
961513906_961513912 4 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513912 3:127421054-127421076 CTGTCTGACTCCAAGAGCCCTGG No data
961513906_961513922 30 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513922 3:127421080-127421102 CACACAGGGGCTGATCCCAGGGG No data
961513906_961513913 5 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513913 3:127421055-127421077 TGTCTGACTCCAAGAGCCCTGGG No data
961513906_961513916 16 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513916 3:127421066-127421088 AAGAGCCCTGGGCTCACACAGGG No data
961513906_961513915 15 Left 961513906 3:127421027-127421049 CCTCCAACAGAGTACTCACCCTG No data
Right 961513915 3:127421065-127421087 CAAGAGCCCTGGGCTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961513906 Original CRISPR CAGGGTGAGTACTCTGTTGG AGG (reversed) Intergenic
No off target data available for this crispr