ID: 961515041

View in Genome Browser
Species Human (GRCh38)
Location 3:127427068-127427090
Sequence CTGGCTCTGCGCCTCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961515041_961515046 16 Left 961515041 3:127427068-127427090 CCAGCGCTGAGGCGCAGAGCCAG No data
Right 961515046 3:127427107-127427129 AGAGAGATCGAGGAAAGAGAAGG No data
961515041_961515045 6 Left 961515041 3:127427068-127427090 CCAGCGCTGAGGCGCAGAGCCAG No data
Right 961515045 3:127427097-127427119 CAATTAAAGCAGAGAGATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961515041 Original CRISPR CTGGCTCTGCGCCTCAGCGC TGG (reversed) Intergenic
No off target data available for this crispr