ID: 961515581

View in Genome Browser
Species Human (GRCh38)
Location 3:127431775-127431797
Sequence CTGTTGGTTTGGAGGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961515575_961515581 11 Left 961515575 3:127431741-127431763 CCTGGCCGCAGTGTGGGCTGGCA No data
Right 961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG No data
961515576_961515581 6 Left 961515576 3:127431746-127431768 CCGCAGTGTGGGCTGGCAGTTCT No data
Right 961515581 3:127431775-127431797 CTGTTGGTTTGGAGGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961515581 Original CRISPR CTGTTGGTTTGGAGGTCAGC TGG Intergenic
No off target data available for this crispr