ID: 961516756

View in Genome Browser
Species Human (GRCh38)
Location 3:127442791-127442813
Sequence AGCCAGGAAGCCCCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961516756_961516768 15 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516768 3:127442829-127442851 TGGGCTGGAGTACACAGTGTGGG No data
961516756_961516770 21 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516770 3:127442835-127442857 GGAGTACACAGTGTGGGAGAGGG No data
961516756_961516762 -4 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516762 3:127442810-127442832 GGCTCCATCTCCTCGCACCTGGG No data
961516756_961516769 20 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516769 3:127442834-127442856 TGGAGTACACAGTGTGGGAGAGG No data
961516756_961516773 28 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516773 3:127442842-127442864 ACAGTGTGGGAGAGGGGACCGGG No data
961516756_961516767 14 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516767 3:127442828-127442850 CTGGGCTGGAGTACACAGTGTGG No data
961516756_961516771 22 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516771 3:127442836-127442858 GAGTACACAGTGTGGGAGAGGGG No data
961516756_961516764 0 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516764 3:127442814-127442836 CCATCTCCTCGCACCTGGGCTGG No data
961516756_961516761 -5 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516761 3:127442809-127442831 TGGCTCCATCTCCTCGCACCTGG No data
961516756_961516772 27 Left 961516756 3:127442791-127442813 CCCTCCCTGGGGGCTTCCTGGCT No data
Right 961516772 3:127442841-127442863 CACAGTGTGGGAGAGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961516756 Original CRISPR AGCCAGGAAGCCCCCAGGGA GGG (reversed) Intergenic
No off target data available for this crispr