ID: 961518369

View in Genome Browser
Species Human (GRCh38)
Location 3:127452605-127452627
Sequence CCCTGAGCAACCATCTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961518364_961518369 9 Left 961518364 3:127452573-127452595 CCTTGGTAATCAGAACATATAGG No data
Right 961518369 3:127452605-127452627 CCCTGAGCAACCATCTGTGGAGG No data
961518363_961518369 10 Left 961518363 3:127452572-127452594 CCCTTGGTAATCAGAACATATAG No data
Right 961518369 3:127452605-127452627 CCCTGAGCAACCATCTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961518369 Original CRISPR CCCTGAGCAACCATCTGTGG AGG Intergenic
No off target data available for this crispr