ID: 961521010

View in Genome Browser
Species Human (GRCh38)
Location 3:127467390-127467412
Sequence TGGGTCCCTGAATTTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961520999_961521010 20 Left 961520999 3:127467347-127467369 CCTGACCTGCACTCTCACCTAAG No data
Right 961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG No data
961521001_961521010 3 Left 961521001 3:127467364-127467386 CCTAAGCCAACTCTCCCTGCCTG No data
Right 961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG No data
961521000_961521010 15 Left 961521000 3:127467352-127467374 CCTGCACTCTCACCTAAGCCAAC No data
Right 961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG No data
961521002_961521010 -3 Left 961521002 3:127467370-127467392 CCAACTCTCCCTGCCTGATCTGG No data
Right 961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG No data
961520998_961521010 21 Left 961520998 3:127467346-127467368 CCCTGACCTGCACTCTCACCTAA No data
Right 961521010 3:127467390-127467412 TGGGTCCCTGAATTTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961521010 Original CRISPR TGGGTCCCTGAATTTGGGCA CGG Intergenic
No off target data available for this crispr