ID: 961523448

View in Genome Browser
Species Human (GRCh38)
Location 3:127481772-127481794
Sequence AGATACCTGCAGAAGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961523448_961523457 14 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523457 3:127481809-127481831 CAGCCTGGAGGCTCCAGGGGTGG No data
961523448_961523453 9 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523453 3:127481804-127481826 ACCTGCAGCCTGGAGGCTCCAGG No data
961523448_961523460 29 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523460 3:127481824-127481846 AGGGGTGGCCTGAGAGATGCTGG No data
961523448_961523456 11 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523456 3:127481806-127481828 CTGCAGCCTGGAGGCTCCAGGGG No data
961523448_961523455 10 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523455 3:127481805-127481827 CCTGCAGCCTGGAGGCTCCAGGG No data
961523448_961523449 -1 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523449 3:127481794-127481816 TTGTGCCTCCACCTGCAGCCTGG No data
961523448_961523450 2 Left 961523448 3:127481772-127481794 CCAGCTCTCTTCTGCAGGTATCT No data
Right 961523450 3:127481797-127481819 TGCCTCCACCTGCAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961523448 Original CRISPR AGATACCTGCAGAAGAGAGC TGG (reversed) Intergenic
No off target data available for this crispr