ID: 961529230

View in Genome Browser
Species Human (GRCh38)
Location 3:127529760-127529782
Sequence ATCACAAATCACTCCACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961529228_961529230 -5 Left 961529228 3:127529742-127529764 CCTAATATCCAGGCTTCAATCAC No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529222_961529230 9 Left 961529222 3:127529728-127529750 CCCACCACATAACCCCTAATATC No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529223_961529230 8 Left 961529223 3:127529729-127529751 CCACCACATAACCCCTAATATCC No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529224_961529230 5 Left 961529224 3:127529732-127529754 CCACATAACCCCTAATATCCAGG No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529227_961529230 -4 Left 961529227 3:127529741-127529763 CCCTAATATCCAGGCTTCAATCA No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529226_961529230 -3 Left 961529226 3:127529740-127529762 CCCCTAATATCCAGGCTTCAATC No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529221_961529230 10 Left 961529221 3:127529727-127529749 CCCCACCACATAACCCCTAATAT No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data
961529220_961529230 17 Left 961529220 3:127529720-127529742 CCAGGAGCCCCACCACATAACCC No data
Right 961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961529230 Original CRISPR ATCACAAATCACTCCACACC AGG Intergenic
No off target data available for this crispr