ID: 961530134

View in Genome Browser
Species Human (GRCh38)
Location 3:127535651-127535673
Sequence CACAGCCACCTTCCTCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 399}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961530122_961530134 18 Left 961530122 3:127535610-127535632 CCTGACTCCCCAGCTGCATCAGG 0: 1
1: 0
2: 3
3: 33
4: 295
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530130_961530134 -8 Left 961530130 3:127535636-127535658 CCCCCTCGCTCTGGTCACAGCCA 0: 1
1: 0
2: 0
3: 19
4: 222
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530131_961530134 -9 Left 961530131 3:127535637-127535659 CCCCTCGCTCTGGTCACAGCCAC 0: 1
1: 0
2: 1
3: 17
4: 214
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530128_961530134 -6 Left 961530128 3:127535634-127535656 CCCCCCCTCGCTCTGGTCACAGC 0: 1
1: 0
2: 1
3: 21
4: 226
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530125_961530134 10 Left 961530125 3:127535618-127535640 CCCAGCTGCATCAGGACCCCCCC 0: 1
1: 0
2: 4
3: 29
4: 343
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530126_961530134 9 Left 961530126 3:127535619-127535641 CCAGCTGCATCAGGACCCCCCCT 0: 1
1: 0
2: 2
3: 19
4: 215
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530132_961530134 -10 Left 961530132 3:127535638-127535660 CCCTCGCTCTGGTCACAGCCACC 0: 1
1: 0
2: 3
3: 21
4: 260
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530129_961530134 -7 Left 961530129 3:127535635-127535657 CCCCCCTCGCTCTGGTCACAGCC 0: 1
1: 0
2: 3
3: 25
4: 256
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399
961530124_961530134 11 Left 961530124 3:127535617-127535639 CCCCAGCTGCATCAGGACCCCCC 0: 1
1: 0
2: 6
3: 45
4: 421
Right 961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG 0: 1
1: 0
2: 2
3: 60
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961530134 Original CRISPR CACAGCCACCTTCCTCCCTT TGG Intergenic
900586550 1:3435099-3435121 CCCAGCCGCCTCCCTCTCTTGGG + Exonic
901124929 1:6922567-6922589 GACAGCCACATTTCTCCCCTGGG + Intronic
902337257 1:15760712-15760734 CCCTGCCTCCTTCCTTCCTTTGG + Intronic
902655149 1:17861945-17861967 CACAGACATCTAGCTCCCTTTGG - Intergenic
902788482 1:18748628-18748650 CACAGCCACTTTCCCCCATGCGG + Intronic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
903237363 1:21958755-21958777 CACTGCCAAATTCCTCTCTTGGG - Intergenic
903269987 1:22181947-22181969 CCCAGCCACCTCCCTCTTTTTGG + Intergenic
903694305 1:25196003-25196025 CGCAGCCACCCTCCTTCCTAGGG + Intergenic
904392406 1:30194764-30194786 AACAGGCACGTTCCTGCCTTGGG - Intergenic
905465708 1:38151579-38151601 CTCAGCCACTTCCCTCCCTGGGG + Intergenic
906544084 1:46609322-46609344 CACACCCACATTCCTCCAATAGG + Exonic
907286782 1:53385562-53385584 CTCAGCCACCCGGCTCCCTTGGG + Intergenic
907303007 1:53500001-53500023 CACAGTCACCTTCTTCTCTCAGG + Intergenic
907789774 1:57650959-57650981 CACACACTCATTCCTCCCTTAGG - Intronic
908584572 1:65554304-65554326 CACAGCCACATTCTTCCCCCAGG + Intronic
911102368 1:94104746-94104768 CAGAGCCCTCCTCCTCCCTTCGG - Intronic
911822161 1:102436200-102436222 CCCAGCCACTTTCCTCCCTGAGG + Intergenic
911973338 1:104463523-104463545 CACAGCCGCCTTGCTCCCTCAGG - Intergenic
913094842 1:115506739-115506761 CACAGCAACCTATCTCCCTCCGG + Intergenic
913497535 1:119442148-119442170 CACTGCCACCTTCACCTCTTGGG + Intergenic
914264503 1:146026968-146026990 CACTGCAACCTCCCTGCCTTGGG + Intergenic
915041620 1:152972415-152972437 CCCAGACACTTTCCTCACTTTGG - Exonic
915222622 1:154387045-154387067 CACAGCCCTCTGCCTCCTTTCGG - Intergenic
915466620 1:156102161-156102183 CACAGGCACATTCCTCCCTTTGG - Intronic
915595122 1:156892829-156892851 CACTGCCACCTTCGTCTCCTGGG + Intergenic
915820329 1:159016567-159016589 CTCGGACACCTTACTCCCTTTGG - Exonic
916147586 1:161754043-161754065 GACAGCCACATTTCTCCTTTAGG + Intronic
917597724 1:176545963-176545985 CACTGCCACCTTCCTCAGTTTGG - Intronic
918285898 1:183054811-183054833 CACAGCCACCTTAGAGCCTTAGG + Intronic
918821980 1:189267930-189267952 CCCAGCCACCTACCTCCCAGAGG - Intergenic
919761624 1:201101752-201101774 CACACCCACCATCCTCCCATGGG - Intronic
920458706 1:206119805-206119827 CACTGCAACCTTCTTCTCTTGGG - Intergenic
920713256 1:208315863-208315885 CACAGCCAGGTTGCTCACTTAGG - Intergenic
921515405 1:216085505-216085527 CACAGCCACCTCCTTTCCTATGG + Intronic
921805002 1:219444172-219444194 CCCAGACACCTTGTTCCCTTAGG + Intergenic
923122893 1:231010001-231010023 CACAGCAACCTCCGTCTCTTGGG - Intergenic
923475136 1:234324947-234324969 CACAGCCGCCTGCCTGCCTTGGG + Intergenic
923562887 1:235054998-235055020 TTCAGCCACCTTCCCCCCTCCGG + Intergenic
923664742 1:235990126-235990148 CACAGCCACATCCCTTCTTTGGG - Intronic
924019577 1:239766785-239766807 CACTGCCACCTTCATCTCGTGGG + Intronic
924205438 1:241707058-241707080 CACAGCCCCCCTTCTCCCTGTGG + Intronic
924571390 1:245240800-245240822 CACAGCCTCCAGCCTCCCTCTGG - Intronic
1065031707 10:21593168-21593190 CACAGCAACCTTCAACTCTTGGG + Intronic
1065234880 10:23638860-23638882 CACTGCAACCTTCATCCTTTGGG - Intergenic
1065477426 10:26155341-26155363 CAAGGCGACCTTCCTTCCTTGGG + Intronic
1066553028 10:36580538-36580560 CTCAGTCACTTTCCTCCCCTGGG - Intergenic
1067720882 10:48726977-48726999 CACACCCTCCTTCCTCTCTGTGG + Intronic
1068538547 10:58267582-58267604 CAGAGCCACCATCCCCCCTCCGG - Exonic
1068854323 10:61782052-61782074 CACAGCCAACTGCCTCCAGTGGG + Intergenic
1070238719 10:74656427-74656449 CAGATCCTCCCTCCTCCCTTGGG - Intronic
1071464302 10:85925492-85925514 CACAGCCACCTGCCACCCCAGGG - Intronic
1071559061 10:86631566-86631588 CGGAGCCACCTTCTTCCCTTTGG + Intergenic
1071576994 10:86734752-86734774 CACAGGGCCCTTCCTACCTTTGG + Exonic
1072403147 10:95126008-95126030 CCCAGCCACTTTTCTCCCTGAGG - Intergenic
1073364854 10:102931132-102931154 CACAACTACCTTCCTTCCATTGG + Intronic
1073462911 10:103676838-103676860 CCCAGCCACCTCCCTCCCTGGGG + Intronic
1073597485 10:104815371-104815393 CACTGCCACCTTCGTCTCCTGGG - Intronic
1074807212 10:117065640-117065662 CACTGCAACCTTCATCTCTTAGG - Intronic
1075040191 10:119101984-119102006 CACTGCAACCGTCCTCTCTTGGG + Intergenic
1075335447 10:121605938-121605960 CACAAACACATTCCTACCTTTGG + Intergenic
1075887424 10:125913387-125913409 CACGCCCTCCTTCCTCCTTTTGG - Intronic
1075905261 10:126075653-126075675 CACTCACACCTTCTTCCCTTCGG - Intronic
1076048640 10:127314814-127314836 CTCAGCCCCCTGCCTCCCCTAGG - Intronic
1076206562 10:128609058-128609080 CACCCCCATCTTCTTCCCTTGGG + Intergenic
1076496097 10:130898741-130898763 CACAGGCACCATCCTCCATGGGG - Intergenic
1076608735 10:131707023-131707045 CAATGCCCCCTTCCTGCCTTCGG + Intergenic
1076826084 10:132970173-132970195 GACAGCCAACTTCTTCCCCTCGG - Intergenic
1076900854 10:133336616-133336638 CACGGCCGCCCTCCTCCCTCGGG - Intronic
1077052055 11:571403-571425 CACAGACACCTGCCTTCCCTAGG + Intergenic
1077058854 11:609028-609050 CACAGCCCCCTTCCTCTCTGGGG - Exonic
1077551225 11:3201145-3201167 CACTGCCACCTTCCAACCTCAGG + Intergenic
1078033998 11:7783716-7783738 CAGAGCCACCTTCTTCCCCTTGG - Intergenic
1078096133 11:8298368-8298390 CACAGCCACCATCATACCTGGGG - Intergenic
1078586868 11:12599418-12599440 CTCAGCCACTTTCCTCCCAGAGG + Intergenic
1079257133 11:18840831-18840853 CACAGCCACCCTTCCCCCTAGGG - Intergenic
1079469598 11:20765632-20765654 CACAAGCTCCTTCCTGCCTTAGG - Intronic
1080205638 11:29725783-29725805 CAGAGCCACCTTCTTCCCCTTGG - Intergenic
1080821478 11:35810833-35810855 CACAGTCACATTCCCTCCTTAGG + Exonic
1081023536 11:37978907-37978929 CACTGCCACCTTCTACGCTTTGG - Intergenic
1081613497 11:44577372-44577394 TCCAGCCACCTTCTTCCCTCAGG + Intronic
1081690552 11:45074967-45074989 CCCAGCCACCTTCCTCATATTGG + Intergenic
1082749021 11:56998174-56998196 TCCAGCCACCTTCCTCCCAGAGG - Intergenic
1083104561 11:60345605-60345627 CACAGCCACTTTCCTTCCAGAGG - Intronic
1084331098 11:68431152-68431174 CTCAGCGACCTTTCTCCCGTGGG + Intronic
1084477500 11:69397166-69397188 CACAGCCTTCTTCCTCCCAGTGG + Intergenic
1085181437 11:74540186-74540208 CTCATCCTCCTTCCTCCCTCCGG - Intronic
1085221163 11:74874727-74874749 CTCAGCCACTTTCCTCCCCAAGG + Intronic
1086086198 11:82957442-82957464 CCCAGCCATCTTCTTCCCCTTGG - Intronic
1086854375 11:91848870-91848892 TCCAGCCAGCTTTCTCCCTTAGG - Intergenic
1088726183 11:112637229-112637251 CACTGCCCCCTTTCTCCTTTAGG + Intergenic
1089787000 11:120914942-120914964 CACAGCCATAATCCTCTCTTGGG - Intronic
1089973462 11:122712678-122712700 CACAGGTACCTTCCTACCTGTGG + Intronic
1091218133 11:133916078-133916100 CAGACCCACCTGCCTCCCTGCGG + Intronic
1091454701 12:598369-598391 CACTGCCAGTTTCCTCCCTCTGG - Intronic
1091547321 12:1510124-1510146 CCCAAACACCTTCCTCCCTCTGG + Intergenic
1091557039 12:1581656-1581678 GACAGCCACATGCCTCCCGTAGG + Intronic
1091979262 12:4852581-4852603 CACATCTACCTGGCTCCCTTTGG - Intergenic
1092285135 12:7124339-7124361 CCCAGCCACCTTCCTTCCTGAGG - Intronic
1093115914 12:15210921-15210943 CAAAACCACCTCCCTCCCTTTGG + Intronic
1093289329 12:17301819-17301841 CACAGCCCCCCTGCTCCCTCAGG + Intergenic
1093594991 12:20949207-20949229 CCCAGCCACTTTCCTCCCCAAGG - Intergenic
1094423535 12:30296574-30296596 GACAGCCTCCTTCCTCTCTTAGG - Intergenic
1094832736 12:34307865-34307887 CAAAGGCACTTTCGTCCCTTGGG - Intergenic
1095208629 12:39467304-39467326 TGGAGCCACCTTCCTCCCCTTGG + Intergenic
1095702109 12:45201165-45201187 CACATCCACCTCTCTGCCTTGGG - Intergenic
1096204991 12:49713885-49713907 CACTGCAACCTTCCCCTCTTGGG - Intronic
1096205005 12:49713971-49713993 CACTGCAACCTTCCCCTCTTGGG - Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096292004 12:50351363-50351385 CACAGGCCCCTCCCTCCCCTGGG - Exonic
1096505248 12:52088482-52088504 CACAGCCAGGTTCTTCCCTCGGG + Intergenic
1096511231 12:52130361-52130383 CACAGCAACCTCCATCCCCTGGG - Intergenic
1096582024 12:52591882-52591904 CACCGCCACCCTCCACCCATAGG + Intronic
1096631059 12:52927083-52927105 CACAGCTTCTTTCCTCCCTTGGG - Intronic
1097706963 12:62878555-62878577 TCCAGCCACCATCCTCCCATGGG - Intronic
1097746966 12:63313192-63313214 TAGAGCCACCTTCCTCCCCAAGG - Intergenic
1098304643 12:69090332-69090354 CTCAGCAGCCTTCCTGCCTTGGG + Intergenic
1100317281 12:93456077-93456099 CCCTGCAAACTTCCTCCCTTTGG + Intergenic
1102146499 12:110658660-110658682 CAGAGCCCCCCTCCTCCCTGCGG + Intronic
1102353362 12:112211608-112211630 CCCTGCCACCATCTTCCCTTGGG - Intronic
1103316179 12:120057713-120057735 CACAGCCACCTTCCAGCCAGGGG - Intronic
1103711814 12:122918269-122918291 CCCCTCCTCCTTCCTCCCTTGGG + Intergenic
1104102065 12:125622117-125622139 CAGACCCACCTTCCTCATTTAGG + Intronic
1104205619 12:126635469-126635491 CTCAGCCACCTCCCACCCATGGG - Intergenic
1104243000 12:127009024-127009046 CAAAGCCACTTTCTTCCTTTAGG + Intergenic
1104813609 12:131633479-131633501 CACACCCACCTGCATCTCTTGGG + Intergenic
1105994478 13:25656975-25656997 CACAGCAACCTTCATCTCCTGGG - Intronic
1106032739 13:26017521-26017543 CCCAGCCTCCTGCCTCCCTCTGG - Intronic
1106235468 13:27857158-27857180 CACTGCAACCTTCGTCCCCTGGG - Intergenic
1107445950 13:40470555-40470577 CACAGTCACCTGCCTTCCTTGGG - Intergenic
1107725306 13:43293067-43293089 CACAGCCACCATCCTCACCATGG + Intronic
1108470208 13:50759901-50759923 GCCAGCCACCTTCCATCCTTTGG + Intronic
1110497349 13:76184289-76184311 CCCATTCACCTTCCTCTCTTTGG - Intergenic
1111012346 13:82328493-82328515 CCCAGCCACTTTCCTCCATGAGG + Intergenic
1112280646 13:98060146-98060168 TACTGCCAACTTCCTCTCTTGGG - Intergenic
1112999635 13:105619036-105619058 CACAATCACTTTCCTCCCTGAGG + Intergenic
1113404325 13:110023805-110023827 CTCAGGCACCTTCCTGGCTTCGG - Intergenic
1113597015 13:111540427-111540449 CCCAGCCACCTTCCTTCCCTGGG + Intergenic
1116101755 14:40447051-40447073 CACAGTCACTTTCCTTCCATTGG - Intergenic
1116941543 14:50796259-50796281 CAAAGCCACCTTCCTCTGATTGG - Intronic
1117462044 14:55954995-55955017 CCCAGCCTCCTTCTTCCTTTAGG - Intergenic
1117590954 14:57268361-57268383 AAAAGCAACCCTCCTCCCTTGGG + Intronic
1117862154 14:60103812-60103834 CACAGCCATATTTCTCCCTTAGG + Intronic
1119357761 14:74021025-74021047 CACATCCACTTTCCTACCTCTGG - Intronic
1120017903 14:79495304-79495326 CACAGCTTCCTTTATCCCTTAGG + Intronic
1120467817 14:84884092-84884114 CACAGCCACATTTCTCCTTATGG - Intergenic
1120722423 14:87903583-87903605 CCCAGGCACCTTCCTTCCTTAGG - Intronic
1121179678 14:91919466-91919488 CACAGCCCTCTTCCTCCAGTGGG - Intronic
1121672843 14:95726090-95726112 TACAGCCACCACCCTCCCTTGGG - Intergenic
1122642630 14:103169320-103169342 TCCAGCCACCTTCCTCCCAGAGG + Intergenic
1122691256 14:103533084-103533106 CGCTGCCACCTTCCTCCATCAGG - Intronic
1122882323 14:104695654-104695676 CAGAGTCACCCTCCTCCCTGTGG + Intronic
1123995689 15:25716405-25716427 CACACCCACCTGCCTACCTGAGG + Intronic
1124234068 15:27971519-27971541 CCCAGCCACAAGCCTCCCTTGGG - Intronic
1124651592 15:31478045-31478067 CACAGGCACCCTCCTGCCTCAGG - Exonic
1125166091 15:36706535-36706557 CACTGCAACCTTCGTCTCTTGGG - Intronic
1125675077 15:41497573-41497595 CACTGCCACCTTCCACCTTAGGG - Intronic
1125832610 15:42727595-42727617 CACGGCTACCCTACTCCCTTTGG - Intronic
1126091028 15:45052140-45052162 CCCAGCCACTTTCCTCCCAGAGG - Intronic
1126142719 15:45450939-45450961 CACTGCCACCCTCTACCCTTCGG - Intergenic
1126302406 15:47212738-47212760 TACAGTCACCTTCCTCTCATCGG - Intronic
1127427143 15:58867648-58867670 CAGAGCCACGTTCCTTCCTGAGG + Intronic
1127568114 15:60213519-60213541 CCCAGGCACCCTCCTCCCCTTGG + Intergenic
1127856405 15:62957253-62957275 CTTAGTCACCTTCCTTCCTTTGG - Intergenic
1128127518 15:65204006-65204028 CACAGGCACATTCCTGCCTCAGG - Intronic
1129267745 15:74403099-74403121 CACAGTCACCTTCCTCTCCTGGG - Intergenic
1129739590 15:77983832-77983854 CACAGCCACGCTCCTCACCTTGG - Intergenic
1129846315 15:78769215-78769237 CACAGCCACGCTCCTCACCTTGG + Intronic
1129964995 15:79726725-79726747 CACACCTCCCTCCCTCCCTTTGG + Intergenic
1130209817 15:81912684-81912706 CACAGAAACCTTCGCCCCTTGGG + Intergenic
1130255178 15:82322657-82322679 CATGGCCACCTGCCTCCCTGTGG - Intergenic
1130255603 15:82324711-82324733 CACAGCCACGTTCCTCACCTTGG - Intergenic
1130403457 15:83578264-83578286 GTCAGCCACCTGCCTCCCTCCGG + Intronic
1130599364 15:85265275-85265297 CACAGCCACGTTCCTCACCTTGG + Intergenic
1132598333 16:763152-763174 CTCTGCCTCCTTCCTCCCCTGGG + Intronic
1132821332 16:1872724-1872746 CACTGCAACCTTCCTCTCCTGGG - Intronic
1134395240 16:13856383-13856405 GATAGCCTCCTTCCTTCCTTGGG - Intergenic
1134444635 16:14321557-14321579 GAGAGCCACCTGCCTCCCTCAGG - Intergenic
1135519574 16:23164440-23164462 TCCAGCCATCTTCCTGCCTTGGG - Intergenic
1137057466 16:35752515-35752537 CCCACCCACCTTCATCCCTGAGG + Intergenic
1137678320 16:50315594-50315616 CACAGCCATCTGCATGCCTTTGG - Exonic
1139225323 16:65228924-65228946 CAAAGCCAACTTTCTCCCTGGGG - Intergenic
1139443733 16:66983572-66983594 CACTGCCACCTCCATCTCTTGGG + Intergenic
1139513619 16:67440948-67440970 CCCAGCCACCTCCTTCCCTGTGG + Intronic
1141797615 16:86285685-86285707 CACAGGTACCTGCCTCCCTCCGG - Intergenic
1141860240 16:86711423-86711445 TACAGCCATCTTCCTCCCTAAGG + Intergenic
1142148776 16:88503576-88503598 CACAGCCAGCTGCCTCTCTGTGG + Intronic
1142813140 17:2405497-2405519 TGCAGCCAGCTTCCTCCCATGGG - Intergenic
1144668719 17:17119247-17119269 CACCACCTCCCTCCTCCCTTGGG - Intronic
1145786681 17:27598236-27598258 CACAGTCACCTTCCTTCCTCTGG - Intronic
1145805774 17:27728323-27728345 CACTGCAACCTTCCTCTCCTGGG - Intergenic
1146461140 17:33046885-33046907 CCCAGTCACCTTCTTCCTTTGGG + Intronic
1146539219 17:33680210-33680232 GACAGTCACCTCCCTCCCATGGG - Intronic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147155148 17:38540949-38540971 CACCGCCACCAGCCTCCCTGTGG - Intronic
1147539395 17:41344492-41344514 CGTGGCCACCTTCTTCCCTTAGG - Intergenic
1148065694 17:44867991-44868013 CACACACACATTCCTCCCCTGGG - Intronic
1148094394 17:45042338-45042360 CTCTGTCACCTTCTTCCCTTGGG + Intronic
1148491632 17:48027136-48027158 CACAGTCTCCCTCCTCTCTTGGG + Intronic
1149494782 17:57110227-57110249 CCCAGCCCCCTCCCTCCCTGAGG - Intronic
1149597566 17:57873274-57873296 AGCACCCCCCTTCCTCCCTTGGG - Intronic
1150797464 17:68249610-68249632 CACACCCAACTTCCTTCTTTTGG - Intronic
1150805911 17:68318982-68319004 CTCAGCCACCCTGCTGCCTTGGG + Intronic
1151197353 17:72441074-72441096 CACAGCCAACTACCTCCCTGTGG - Intergenic
1151353784 17:73546562-73546584 CCCAGACACCTTGCTCCCTCTGG - Intronic
1151666669 17:75549323-75549345 CACAGCCAGCTCGCTCCCCTCGG + Intronic
1151758887 17:76089689-76089711 CACAGCCACCTGCCCACCCTGGG - Intronic
1153565715 18:6415064-6415086 CGCAGCCACCTCCCTCCCATGGG - Intronic
1153586432 18:6625589-6625611 CCCACCCAACTTCCTCCCTTTGG + Intergenic
1154272606 18:12932956-12932978 GAGAGCCACCTTTCTACCTTAGG - Intergenic
1155351892 18:24915003-24915025 CACAGCCAGCTTCCTCCACCAGG - Intergenic
1155839417 18:30628327-30628349 TCCAGCCACCTTCCTCCCAGAGG - Intergenic
1159009026 18:63040803-63040825 CCCAGCCCCCTTCCTCCATAGGG - Intergenic
1159117881 18:64136068-64136090 CACTGCCACATTCTTCCCTGAGG - Intergenic
1159268610 18:66118852-66118874 CCCAGCCACCTTCCCCGCTTTGG + Intergenic
1160231477 18:77052733-77052755 CACAGCCACTATCCTCGCCTTGG + Intronic
1160601925 18:80020265-80020287 CCCAGCCACTTTCCTCCCAGAGG - Intronic
1160672334 19:371712-371734 GACAGACACTTTCATCCCTTGGG - Intronic
1161411508 19:4120771-4120793 TACAGCCAGCTTCCTCTCCTGGG + Intronic
1161569453 19:5022574-5022596 CACTTCCACCTGCCTCACTTAGG + Intronic
1162123550 19:8486822-8486844 CACAGCCAGCTCCCTCCCTGGGG - Intronic
1162323639 19:9985825-9985847 CACCCCCAGCTTCCTACCTTAGG + Exonic
1163130883 19:15272273-15272295 CACAGCCACCTTTCTCCAACTGG + Intronic
1163419303 19:17205323-17205345 TACACTCACCTTCCTCCCGTAGG - Exonic
1163812524 19:19442641-19442663 CACAGCCAGCTTAAACCCTTGGG - Intronic
1164397830 19:27881249-27881271 TCCAGCCACCTTCCTCCCCAAGG + Intergenic
1164481087 19:28611471-28611493 CACAGCCCCCCTGCTCCCTCAGG + Intergenic
1164876708 19:31695938-31695960 CACACCCACTGTCTTCCCTTGGG - Intergenic
1165757238 19:38301051-38301073 CACAGGCACATTCCTGCCTCAGG + Intronic
1166374937 19:42322462-42322484 CTCAGCCAGCTTCCTTCCTAAGG + Intronic
1166996807 19:46723294-46723316 CACAGCCCATTTCCTCCCTGCGG - Intronic
1167482219 19:49740041-49740063 CTCAGCCTCCTTCCTCACTCTGG + Exonic
1167667073 19:50828588-50828610 CACATCCAGCTTCCACACTTAGG + Intronic
1168239946 19:55083887-55083909 CCCAGCCCCCTTCCTCCCTTAGG - Intronic
925415635 2:3668333-3668355 CACAAGCACCTCCCTCACTTAGG - Intronic
926006712 2:9378497-9378519 CTCAGCCTCCGTCCTCCCGTGGG + Intronic
926117023 2:10219870-10219892 CACGGCCTCCTACCTCCCCTCGG + Intergenic
929393668 2:41498372-41498394 CCCAGCCACTTTCCTCCCCAAGG + Intergenic
930527468 2:52547936-52547958 CACTGCAACCTTTGTCCCTTGGG + Intergenic
931345180 2:61439741-61439763 CACAGCCTCCTGCCTCCCTGCGG - Intronic
932729681 2:74209951-74209973 CACAACCACATTCTTCCCTAGGG - Exonic
933199455 2:79432578-79432600 CACTTCCAACTTCCTCCCTTTGG - Intronic
934480832 2:94641689-94641711 CACTTTCACCTTCCTCCCATGGG - Intergenic
937167502 2:119835258-119835280 CACTGCAACCTTCGTCCCCTGGG + Intronic
937555950 2:123156194-123156216 CACAGCCCCTTTCCTCAATTAGG - Intergenic
937636138 2:124157211-124157233 CACAGCCACCCTCTTCCCCTGGG + Intronic
938140244 2:128789483-128789505 CACAGGGACCTCCTTCCCTTTGG - Intergenic
939241059 2:139560231-139560253 CACTGCAACCTCCGTCCCTTGGG - Intergenic
940084811 2:149847220-149847242 CATATCCACCTTTCTTCCTTGGG - Intergenic
940252592 2:151695882-151695904 CAGAGCCACCTCATTCCCTTAGG - Intronic
940838137 2:158548444-158548466 CAGGGCCACCTTCTTCCCCTTGG - Intronic
941510143 2:166397300-166397322 CCCTCCCACCTTCCTCACTTTGG + Intergenic
941671568 2:168299500-168299522 CACTGCCACCTTCACCTCTTGGG + Intergenic
943382967 2:187173384-187173406 TCCAGCCACCTTCCTCCCAGAGG - Intergenic
944447456 2:199805661-199805683 CACTGCAACCTTCGTCTCTTGGG - Intronic
944856515 2:203773234-203773256 TACAGCCAACTGCTTCCCTTGGG - Intergenic
944965047 2:204921845-204921867 CACTGCCACCCTCCTACTTTGGG - Intronic
945796190 2:214367044-214367066 CACAGGAACCCTCCTCCCTAGGG - Intronic
946024587 2:216664314-216664336 CACAACCCCCTTCCTCCCCCGGG - Exonic
946703242 2:222433250-222433272 CACAGCCAGCTTCTTTCCTAAGG - Intronic
946876067 2:224131035-224131057 CACTGCAACCTTTGTCCCTTGGG - Intergenic
947268062 2:228304322-228304344 TCCAGCCACCTTCCTCCCTGAGG - Intergenic
948218840 2:236253157-236253179 CACACCCACCATCCTCCCAGTGG - Intronic
948904568 2:240972453-240972475 CACAGCAACCCTCTTCCCTGAGG + Intronic
1168926771 20:1588085-1588107 TTCAGCCACCGTCCTCCCTAAGG - Intronic
1168930481 20:1619383-1619405 TTCAGCCACCATCCTCCCTAAGG - Intronic
1169135061 20:3192210-3192232 CACCGCCTCCTTCCTCCCTATGG - Intronic
1172094171 20:32452588-32452610 CCCAGCCACCTTCCCCCCGGGGG + Intronic
1172565181 20:35924666-35924688 CACTGCAACCTTCCTCTCCTGGG + Intronic
1172875878 20:38164190-38164212 CTCAGCCACCTGCCTCCCTCGGG - Intronic
1173079465 20:39851803-39851825 CACAGTCTCCTTCCTTCCCTAGG - Intergenic
1173291732 20:41720870-41720892 CACTGCAACCTTCATCCCCTGGG - Intergenic
1173610775 20:44365929-44365951 CACAGCAACCTTCACCTCTTGGG - Intronic
1174115998 20:48226616-48226638 CACCACCACCTTCCTGCCCTGGG - Intergenic
1175064597 20:56274115-56274137 CCCAGCCACTTTCCTCCCAGAGG + Intergenic
1175814922 20:61878304-61878326 CACAGCCACCTTCCAGCCGGGGG - Intronic
1175870955 20:62209215-62209237 CAGAGCCACAGACCTCCCTTGGG + Intergenic
1176047401 20:63099988-63100010 CACAGCCCCTTTCCTCACTGGGG - Intergenic
1177125003 21:17183698-17183720 TTCAGCCACCTTCCTCCCAGGGG + Intergenic
1179437097 21:41369553-41369575 CTCAGCGGCTTTCCTCCCTTGGG - Intronic
1179507726 21:41852816-41852838 CACATCCACCTACCACCTTTGGG + Intronic
1180966678 22:19792313-19792335 CAGAGCCACCTTCTTTCCCTTGG - Intronic
1181142533 22:20816972-20816994 CACTGCCACCTGCCTGCCTTTGG - Intronic
1181854894 22:25774636-25774658 CACAGCCACCTCCTGTCCTTAGG + Intronic
1182387762 22:29960233-29960255 CACAGCAATATTCCCCCCTTTGG - Intronic
1184184577 22:42856536-42856558 CACAGCCTCCTCCCTCTCCTCGG - Intronic
1185008841 22:48301767-48301789 CAGAGCCAACTGCCTCCCTGAGG - Intergenic
950039168 3:9908792-9908814 CTCTGCCATCATCCTCCCTTAGG - Intronic
952684696 3:36134309-36134331 CCCAGCCACCTTTCTCCCAGAGG + Intergenic
952959392 3:38580102-38580124 CACATCCTCCTGCCTCCCTGTGG - Intronic
954170928 3:48801671-48801693 CACTGCCACCTTCGTCTCCTGGG + Intronic
954875311 3:53799420-53799442 CACAGCTGCCTTCCTCACTGTGG - Intronic
956557379 3:70538739-70538761 CCCAGCCACCTTCCTCCCAGAGG - Intergenic
957625440 3:82648196-82648218 CCCAGCCACCTTCCTTCCAGAGG + Intergenic
958450342 3:94265352-94265374 CACAGCCTACTTCATCCCCTTGG + Intergenic
958554360 3:95655423-95655445 CACAACCACATTCTTCCCTAGGG + Intergenic
958893848 3:99808710-99808732 CATTTCCACCTTGCTCCCTTGGG - Intergenic
959521011 3:107322924-107322946 CAAAGCCATCTACTTCCCTTGGG + Intergenic
960045517 3:113193590-113193612 CCCACCCACCTTCCTCCCTGTGG - Intergenic
960158092 3:114318310-114318332 CACAGCCATTTCCCTCCTTTGGG + Intergenic
960619983 3:119628164-119628186 CACAGCCACCTTGCCAGCTTAGG + Intronic
961489400 3:127243204-127243226 GACAGCCACATCCCTGCCTTGGG - Intergenic
961530134 3:127535651-127535673 CACAGCCACCTTCCTCCCTTTGG + Intergenic
961567041 3:127771274-127771296 CCCAGCGACCATCCTCCCTCTGG + Intronic
962448918 3:135495004-135495026 TACATCCACCTTCCTCCTTCAGG + Intergenic
963642836 3:147880087-147880109 CCCAGCCACCTTCCTCCCAGGGG - Intergenic
963807667 3:149741595-149741617 CCCAGCCACCCTGCTCCATTTGG - Exonic
965300060 3:166997544-166997566 TCCAGCCACCTTCCTCCCAGGGG - Intergenic
966343187 3:178948246-178948268 GCAAGCCACCTTCCTCCCTAAGG + Intergenic
966392241 3:179464916-179464938 CACAACCACATTCTTCCCTAGGG - Intergenic
966576241 3:181505841-181505863 TAGAGCCACCTTCTTCCCGTTGG + Intergenic
967920104 3:194608147-194608169 CCCTGCCTCCTCCCTCCCTTCGG + Intronic
968604294 4:1524570-1524592 CACCACCACCTTCGTCCCTAGGG + Intergenic
969251903 4:5973670-5973692 CACGGCCACCTTCCTGGCTCCGG - Exonic
969491154 4:7499921-7499943 CCCAGCCGCCTGCCTCCCCTGGG - Intronic
970404953 4:15753986-15754008 CTCAGTCACCTTCCTTCCTTTGG + Intergenic
971485251 4:27153361-27153383 CACAGCTGCCTTCATCCCTGGGG - Intergenic
972064364 4:34921991-34922013 CAGACCCACCATCATCCCTTAGG + Intergenic
972276839 4:37565499-37565521 CACAGACACCTTCCTCCCCCAGG + Intronic
973986175 4:56356151-56356173 CAGAGCCACCTTCTTTCCCTTGG - Intronic
974207767 4:58728657-58728679 CACATTCACCTTCCTCCCACTGG - Intergenic
975657595 4:76657099-76657121 CACTGCAACCTTCATCTCTTGGG - Intronic
976699695 4:87956337-87956359 CACAGCAACCCACCTCCCTTCGG + Intergenic
978491800 4:109317897-109317919 ACCAGCCACCTTCCTCCCAGAGG + Intergenic
979011504 4:115376523-115376545 CACTGCCACCTCCCTCTCCTAGG + Intergenic
980921263 4:139088209-139088231 CACTGCAACCTTCCTCTCCTGGG - Intronic
982076743 4:151744937-151744959 CACAGACACATACCTCCTTTAGG + Intronic
982359836 4:154507524-154507546 CCCAGCCTTCTTCCTCTCTTTGG + Intergenic
983620931 4:169760139-169760161 CCCAGCCTCCTTCCTGCATTGGG - Intergenic
985287390 4:188349983-188350005 CGGAGCCACCTTCTTCCCCTTGG + Intergenic
985533576 5:448403-448425 CACAGCCTCATCCCTCCCCTTGG + Intronic
986819328 5:11447680-11447702 CACAGCCCCCATCCGCCCTCAGG - Intronic
988337289 5:29922912-29922934 CCCAGCCACTTTCCTTCCTGTGG - Intergenic
989484039 5:41967597-41967619 CACAACCACATTCTTCCCTAGGG + Intergenic
989494754 5:42099881-42099903 CAGGGCAACCTTCCACCCTTTGG - Intergenic
990424778 5:55676059-55676081 CACATCCTCCATCCTCCCTAGGG - Intronic
993737849 5:91498968-91498990 CACAGCCAAGCTGCTCCCTTTGG - Intergenic
994081378 5:95711627-95711649 TACAACCAACTTGCTCCCTTAGG - Intergenic
994720506 5:103374290-103374312 CTCAGCCCCCATCCTCCCTTTGG - Intergenic
995176188 5:109180221-109180243 CTCAGCCACTTTCCAACCTTTGG + Intronic
995176885 5:109188288-109188310 CCCAGCCCCCTCCCTCCTTTGGG + Exonic
995416992 5:111923431-111923453 TCCAGCCACCTTCCTCCCAGAGG - Intronic
996118876 5:119648754-119648776 CACAGCCTCCATTCTCGCTTTGG - Intergenic
997222703 5:132182217-132182239 CACTGCAACCTTCGTCCCCTGGG - Intergenic
1000027523 5:157372827-157372849 GGCAGCCACCCTCCTCCCATTGG + Intronic
1000116581 5:158159690-158159712 CACAGCACCCTTCCTTCCTTGGG + Intergenic
1001763968 5:174230439-174230461 CGCAGCCACATTCCTACCTCTGG + Intronic
1002399881 5:178985835-178985857 CACAGCAACCTTCAACTCTTGGG + Intronic
1002606056 5:180383402-180383424 CAGAGCCACCTCCCTGCCTGTGG - Intergenic
1003175072 6:3748269-3748291 AACAGCTACCTCCCTCCCCTAGG + Intronic
1003840911 6:10118471-10118493 CGCAGCCACCTTCTTCCCCTTGG - Intronic
1004973806 6:20942441-20942463 CACTGCAACCTTCCTCTCCTGGG + Intronic
1005995533 6:30928952-30928974 AACAGCCATCCTCCTCCTTTTGG - Intergenic
1007477722 6:42130108-42130130 CCCAGCCAGCTTCCTGCCTTGGG - Intronic
1008671437 6:53773165-53773187 CACACCCAGCTTCCTTCCTCAGG + Intergenic
1008786385 6:55174222-55174244 CACAGCCTCCTCCCTCGCTGAGG - Exonic
1011050725 6:83146400-83146422 CACACACATCTTACTCCCTTTGG - Intronic
1011263068 6:85488654-85488676 CACTGCAACCTCCGTCCCTTGGG + Intronic
1011755267 6:90492438-90492460 CACGTCCATCTTGCTCCCTTTGG - Intergenic
1013446444 6:110233322-110233344 AACAGACACTTTCCTCCCATTGG - Intronic
1014276663 6:119396796-119396818 TCCAGCCACCTTCCTCCCAGAGG - Intergenic
1015568936 6:134602221-134602243 CAGAGCCTACTTTCTCCCTTTGG - Intergenic
1016119477 6:140329066-140329088 TAGAGCCACCTTCCTCCCAGAGG - Intergenic
1016947873 6:149550901-149550923 TCCAGCCACCTTCCTCCCTGAGG - Intergenic
1017889271 6:158625490-158625512 CACAGCCACCATCCTCTGGTGGG - Intronic
1018213708 6:161506659-161506681 CACAGCCACCTGCCACTCCTGGG - Intronic
1018218388 6:161552864-161552886 CACTGCAACCTTCATCTCTTGGG + Intronic
1018238258 6:161747248-161747270 CAATGCCTCCTTCCTCTCTTTGG + Intronic
1018484685 6:164228847-164228869 CTCAGGCTCCTTCCTACCTTTGG + Intergenic
1019501780 7:1368454-1368476 CAAAGCTGCCTTTCTCCCTTGGG - Intergenic
1019661279 7:2225352-2225374 CACAGCCCCCTTGCTTCCTGGGG + Intronic
1019935000 7:4249077-4249099 CACACTCACCTCCCTCCCTGAGG - Intronic
1020763382 7:12293431-12293453 CCCAGCCACCTTCCTCCCAAAGG + Intergenic
1021420686 7:20442182-20442204 GACAGCCACATTCCTCCCAGAGG - Intergenic
1021893709 7:25212922-25212944 CGGAGCCACCTTCTTCCCCTTGG + Intergenic
1022382197 7:29870879-29870901 CACTGCCACCTCCCTCTCCTGGG - Intronic
1024818245 7:53295933-53295955 GACAACCACTGTCCTCCCTTTGG + Intergenic
1025059443 7:55791914-55791936 CACTGCAACCTCCCACCCTTGGG - Intergenic
1025923119 7:65933000-65933022 CACTGCAACCTCCATCCCTTGGG - Intronic
1026788072 7:73314126-73314148 CGGAGCCACCTTCTTCCCCTTGG - Intronic
1027332727 7:77116151-77116173 CAGAGCCAACTTCTTCCCCTTGG + Intergenic
1028251357 7:88543034-88543056 CCCAGACACTTTCCTCCCTGAGG - Intergenic
1028487117 7:91372194-91372216 CACAGCCACCGTCCTAGCTCAGG + Intergenic
1029341910 7:99951934-99951956 CACTGCAACCTTCGTCTCTTGGG - Intergenic
1029600894 7:101562929-101562951 CACAGCCACCTCTCTCATTTTGG + Intergenic
1029783055 7:102755165-102755187 CAGAGCCAACTTCTTCCCCTTGG - Intronic
1029816503 7:103101913-103101935 CTAATCCACCTCCCTCCCTTAGG + Exonic
1031665918 7:124481842-124481864 CACAGCCAGCTTTCTCCATATGG + Intergenic
1033673449 7:143514639-143514661 CTAAGCCACCTTCCTCCCCCAGG + Intergenic
1034231326 7:149530899-149530921 CCCAGCCACTTTCCTCCCAAAGG + Intergenic
1034264617 7:149774890-149774912 AGCAGCCCCCTTCCTCCCCTAGG + Intergenic
1034345935 7:150385105-150385127 CCTCGCCACCCTCCTCCCTTGGG - Intronic
1034458637 7:151186162-151186184 CACAGCCTCCCTCCACCCCTGGG + Intronic
1034541652 7:151762314-151762336 CCAAGCCTCCTTCCTCCATTGGG - Intronic
1035448589 7:158959525-158959547 CACAGCCACCTTGTTCTCTTAGG + Intergenic
1035695713 8:1594071-1594093 CACAGCTACCTTCTTCTCTCTGG + Intronic
1036595104 8:10204996-10205018 CACAGCCACCCTGATCCCTCAGG - Intronic
1036786611 8:11692211-11692233 CAGTTCCACCTTCCTCCCTCTGG - Intronic
1037166086 8:15830753-15830775 CCCTTCCACCTTCCTCCCTTTGG - Intergenic
1037236179 8:16721671-16721693 CCCAGCCACCTTACTCCTTTTGG + Intergenic
1037405975 8:18542938-18542960 CACACTCAGCTTCCTTCCTTAGG + Intronic
1037694002 8:21207917-21207939 CACAGCCAGCTTCCCCTCTGAGG + Intergenic
1039883946 8:41645128-41645150 CACAGCCAGTTTCCTGCCGTTGG + Intergenic
1042761946 8:72280719-72280741 CCCAGCCACTTTCCTCCCTGAGG + Intergenic
1044984406 8:97745093-97745115 CACAGCAACCTTCATCTCCTGGG - Intergenic
1045230512 8:100301976-100301998 ACCAGACACATTCCTCCCTTAGG - Intronic
1045529267 8:102969416-102969438 CACTGCAACCTTCGCCCCTTGGG + Intronic
1048162925 8:132037581-132037603 CTCAGCCCCTTTCCTCCCTTGGG - Intronic
1048982683 8:139711439-139711461 CACAGCCAGCTCCCTCCCTGTGG + Intergenic
1049069761 8:140347270-140347292 CCCAGCCACCTGCCTGCCTCAGG + Intronic
1049840353 8:144767058-144767080 CCCAGCCTCTTTCCTCCCTGTGG - Intergenic
1050611691 9:7360506-7360528 TTCACACACCTTCCTCCCTTAGG - Intergenic
1051160679 9:14204267-14204289 CGGAGCCACCTTCTTCCCCTTGG - Intronic
1051781231 9:20691016-20691038 CACTGCAACCTTCATCTCTTGGG + Intronic
1053174729 9:35914539-35914561 CACAGCCACCTCCTGCCCTTGGG - Intergenic
1053208642 9:36209021-36209043 CACTGCCAACTTCATCCCTTTGG - Intronic
1053436645 9:38079979-38080001 TACAGCCCACTTCCTCCCTGAGG + Intergenic
1053634670 9:39984360-39984382 CAGCACCACCTTCTTCCCTTTGG + Intergenic
1053677007 9:40442277-40442299 CACTTTCACCTTCCTCCCATGGG + Intergenic
1053926771 9:43068377-43068399 CACTTTCACCTTCCTCCCATGGG + Intergenic
1054209217 9:62266337-62266359 CAGCACCACCTTCTTCCCTTTGG - Intergenic
1054286711 9:63182628-63182650 CACTTTCACCTTCCTCCCATGGG - Intergenic
1054290077 9:63277806-63277828 CACTTTCACCTTCCTCCCATGGG + Intergenic
1054388106 9:64582346-64582368 CACTTTCACCTTCCTCCCATGGG + Intergenic
1054507616 9:65934022-65934044 CACTTTCACCTTCCTCCCATGGG - Intergenic
1054554090 9:66636243-66636265 CAGAGCCACCTTTCTTCCTGAGG - Intergenic
1055980182 9:81993308-81993330 CTCAGCCACCTTCATCTCTCAGG + Exonic
1056212977 9:84382187-84382209 GACAGCCACCCTCCTGCCTCCGG - Intergenic
1057423382 9:94929425-94929447 CCCAGCCAGCTCCCTCCCTGGGG - Intronic
1057571128 9:96204768-96204790 CACAGCCAAGTGACTCCCTTGGG + Intergenic
1058292642 9:103261324-103261346 CACTGCAACCTTCCTCTCCTGGG + Intergenic
1058486478 9:105447663-105447685 CCCAGCCCTTTTCCTCCCTTTGG + Intergenic
1059605459 9:115830108-115830130 CACAGCAACCTTCGCCTCTTGGG + Intergenic
1060698193 9:125728222-125728244 CAGAACTACCTTCCTGCCTTTGG - Intergenic
1061118631 9:128629751-128629773 CACAGCCATCTCTCTCCTTTTGG + Intronic
1061704452 9:132442109-132442131 CATAGCCCCCGCCCTCCCTTGGG + Intronic
1062460840 9:136661970-136661992 CAAAGCCACCCAGCTCCCTTCGG + Intronic
1062674875 9:137736134-137736156 GATAGCCACCTTGCTCTCTTTGG - Intronic
1062730594 9:138106119-138106141 CACAGCCAGCGCCCTCCCTGGGG + Intronic
1185480624 X:443735-443757 CCCGACCACCTTCCTCCCTTGGG - Intergenic
1185727396 X:2433046-2433068 CACTGCAACCTCCATCCCTTGGG - Intronic
1186525536 X:10244784-10244806 CAAAGCCACATTCCTTGCTTCGG + Intergenic
1187368446 X:18683867-18683889 CCCAGGCACCTTCCTTCTTTAGG - Intronic
1188765855 X:34089636-34089658 TCCAGCCACCTTCCTCCCAGAGG + Intergenic
1189103082 X:38211095-38211117 CACAGCCATGTTCATTCCTTTGG - Intronic
1190385448 X:49879382-49879404 CACAGCCACCGCGCTCCCTCAGG + Intergenic
1191697261 X:64003056-64003078 CACAGGTGCCTTCCTGCCTTGGG - Intergenic
1194083923 X:89502625-89502647 CTCTTCCACCTTCTTCCCTTTGG + Intergenic
1195093173 X:101482969-101482991 CACTGCAACCTCCATCCCTTGGG + Intronic
1195465080 X:105171447-105171469 CAAGGCCAGCTTGCTCCCTTTGG + Intronic
1195721631 X:107874209-107874231 TCCAGCCACCTTCCTCCCAGAGG - Intronic
1196201944 X:112896544-112896566 CACAGCAACCTGCCTCCTTAAGG - Intergenic
1197250773 X:124214406-124214428 CACTTCCACCTTGCTCTCTTGGG - Intronic
1197355681 X:125435701-125435723 CCCAGCCACTTTCCTCCCTGAGG - Intergenic
1197606221 X:128588381-128588403 CACTGCAACCTTCGTCCCTGGGG - Intergenic
1199045006 X:143159505-143159527 CCAGGCAACCTTCCTCCCTTTGG + Intergenic
1200211593 X:154349067-154349089 CCCAGCCCCCTTCCTCCCGCTGG + Intronic
1200249064 X:154542543-154542565 CACACCCAGCTTCCTTCCTGGGG - Intronic
1200436570 Y:3158505-3158527 CTCTTCCACCTTCTTCCCTTTGG + Intergenic
1201337269 Y:12894361-12894383 CCCTGCCACCTTCCTCCCAGAGG + Intergenic
1201449012 Y:14089753-14089775 CACCTCCACCTTCCTCACTTCGG - Intergenic
1202037334 Y:20648193-20648215 CACAGCCCCCCTGCTCCCTCAGG + Intergenic