ID: 961530495

View in Genome Browser
Species Human (GRCh38)
Location 3:127537271-127537293
Sequence TCATTACCCCCGGCTGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961530495_961530503 -1 Left 961530495 3:127537271-127537293 CCTCAGCCAGCCGGGGGTAATGA No data
Right 961530503 3:127537293-127537315 AGGCATGGGATGGACTCTGCGGG No data
961530495_961530504 6 Left 961530495 3:127537271-127537293 CCTCAGCCAGCCGGGGGTAATGA No data
Right 961530504 3:127537300-127537322 GGATGGACTCTGCGGGCACCAGG No data
961530495_961530502 -2 Left 961530495 3:127537271-127537293 CCTCAGCCAGCCGGGGGTAATGA No data
Right 961530502 3:127537292-127537314 GAGGCATGGGATGGACTCTGCGG No data
961530495_961530506 28 Left 961530495 3:127537271-127537293 CCTCAGCCAGCCGGGGGTAATGA No data
Right 961530506 3:127537322-127537344 GCCTGACCCTGAGTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961530495 Original CRISPR TCATTACCCCCGGCTGGCTG AGG (reversed) Intergenic
No off target data available for this crispr