ID: 961530553

View in Genome Browser
Species Human (GRCh38)
Location 3:127537492-127537514
Sequence TGCAGGGCATTGAGGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961530553_961530558 -7 Left 961530553 3:127537492-127537514 CCTCTGGCCCTCAATGCCCTGCA No data
Right 961530558 3:127537508-127537530 CCCTGCAACCTGGCCTCTCCTGG No data
961530553_961530560 -6 Left 961530553 3:127537492-127537514 CCTCTGGCCCTCAATGCCCTGCA No data
Right 961530560 3:127537509-127537531 CCTGCAACCTGGCCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961530553 Original CRISPR TGCAGGGCATTGAGGGCCAG AGG (reversed) Intergenic
No off target data available for this crispr