ID: 961530884

View in Genome Browser
Species Human (GRCh38)
Location 3:127539710-127539732
Sequence CTGACATTTCTTCTCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961530884_961530885 15 Left 961530884 3:127539710-127539732 CCAGGTGAGAGAAGAAATGTCAG No data
Right 961530885 3:127539748-127539770 AAGAAGAAAGCCAGCTATGAAGG No data
961530884_961530886 18 Left 961530884 3:127539710-127539732 CCAGGTGAGAGAAGAAATGTCAG No data
Right 961530886 3:127539751-127539773 AAGAAAGCCAGCTATGAAGGTGG No data
961530884_961530888 30 Left 961530884 3:127539710-127539732 CCAGGTGAGAGAAGAAATGTCAG No data
Right 961530888 3:127539763-127539785 TATGAAGGTGGCCCCGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961530884 Original CRISPR CTGACATTTCTTCTCTCACC TGG (reversed) Intergenic
No off target data available for this crispr