ID: 961530885

View in Genome Browser
Species Human (GRCh38)
Location 3:127539748-127539770
Sequence AAGAAGAAAGCCAGCTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961530883_961530885 19 Left 961530883 3:127539706-127539728 CCAGCCAGGTGAGAGAAGAAATG No data
Right 961530885 3:127539748-127539770 AAGAAGAAAGCCAGCTATGAAGG No data
961530884_961530885 15 Left 961530884 3:127539710-127539732 CCAGGTGAGAGAAGAAATGTCAG No data
Right 961530885 3:127539748-127539770 AAGAAGAAAGCCAGCTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961530885 Original CRISPR AAGAAGAAAGCCAGCTATGA AGG Intergenic
No off target data available for this crispr