ID: 961530888

View in Genome Browser
Species Human (GRCh38)
Location 3:127539763-127539785
Sequence TATGAAGGTGGCCCCGTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961530884_961530888 30 Left 961530884 3:127539710-127539732 CCAGGTGAGAGAAGAAATGTCAG No data
Right 961530888 3:127539763-127539785 TATGAAGGTGGCCCCGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961530888 Original CRISPR TATGAAGGTGGCCCCGTCGC AGG Intergenic
No off target data available for this crispr