ID: 961532217

View in Genome Browser
Species Human (GRCh38)
Location 3:127546865-127546887
Sequence CTGAAGTTCTAGGGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961532207_961532217 9 Left 961532207 3:127546833-127546855 CCCGTGGAGACAGAGACTGGGAG No data
Right 961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG No data
961532208_961532217 8 Left 961532208 3:127546834-127546856 CCGTGGAGACAGAGACTGGGAGG No data
Right 961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961532217 Original CRISPR CTGAAGTTCTAGGGGGAAAA AGG Intergenic
No off target data available for this crispr