ID: 961532538

View in Genome Browser
Species Human (GRCh38)
Location 3:127548009-127548031
Sequence CCCCTACGGCCTCCAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961532529_961532538 10 Left 961532529 3:127547976-127547998 CCCGGGCTGCACTGGGGGCGAGA No data
Right 961532538 3:127548009-127548031 CCCCTACGGCCTCCAGAGGCCGG No data
961532530_961532538 9 Left 961532530 3:127547977-127547999 CCGGGCTGCACTGGGGGCGAGAG No data
Right 961532538 3:127548009-127548031 CCCCTACGGCCTCCAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961532538 Original CRISPR CCCCTACGGCCTCCAGAGGC CGG Intergenic
No off target data available for this crispr