ID: 961535794

View in Genome Browser
Species Human (GRCh38)
Location 3:127569734-127569756
Sequence TGGGATTCCCCCCGCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961535794_961535801 26 Left 961535794 3:127569734-127569756 CCCACATAGCGGGGGGAATCCCA No data
Right 961535801 3:127569783-127569805 ATGTTGCTGAGTTTCCACCATGG No data
961535794_961535796 -8 Left 961535794 3:127569734-127569756 CCCACATAGCGGGGGGAATCCCA No data
Right 961535796 3:127569749-127569771 GAATCCCACCACAGCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961535794 Original CRISPR TGGGATTCCCCCCGCTATGT GGG (reversed) Intergenic
No off target data available for this crispr