ID: 961537076

View in Genome Browser
Species Human (GRCh38)
Location 3:127576797-127576819
Sequence TGTGTGTACCGCTGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961537076_961537086 17 Left 961537076 3:127576797-127576819 CCAAGAGCCCAGCGGTACACACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 961537086 3:127576837-127576859 GATGATCACACTCAGCTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
961537076_961537081 -5 Left 961537076 3:127576797-127576819 CCAAGAGCCCAGCGGTACACACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 961537081 3:127576815-127576837 ACACACCAAAGGCCAGGCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 310
961537076_961537087 25 Left 961537076 3:127576797-127576819 CCAAGAGCCCAGCGGTACACACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 961537087 3:127576845-127576867 CACTCAGCTCGATGGCCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961537076 Original CRISPR TGTGTGTACCGCTGGGCTCT TGG (reversed) Intronic
900309173 1:2025114-2025136 TGTGTGGCCCACTGGGCTGTAGG + Intronic
903212197 1:21824507-21824529 TGGGTATCCGGCTGGGCTCTTGG - Exonic
903489737 1:23719249-23719271 TGTGTGTACCCCTAGGCCCAAGG + Intergenic
904671744 1:32171173-32171195 TTTGTCTACCCCTGGGCTCCTGG - Exonic
905387071 1:37612450-37612472 AGTGTGTACTGCTGGGCCCGAGG + Exonic
906044737 1:42819461-42819483 TGTGTCTACCAGTGGACTCTTGG + Intronic
911391770 1:97254231-97254253 TGTATGTACCTATTGGCTCTAGG + Intronic
913516033 1:119606447-119606469 TGTGTGTCCTGCTAGGGTCTTGG + Intergenic
916714967 1:167440642-167440664 GGTGGGTACCACTGGGCTTTGGG - Exonic
917239198 1:172929383-172929405 TGTGTTTACCTCTGGGGTTTAGG + Intergenic
920098009 1:203499129-203499151 TGTGTGATCAGCTGGCCTCTGGG + Intronic
922880327 1:228975663-228975685 AGTGTGCCCCGCTGTGCTCTTGG + Intergenic
1062941750 10:1427004-1427026 TGTGTACTCCGCTGGGCTCCAGG + Intronic
1064195480 10:13240808-13240830 TTTGTGTATCGCTGGGCTTAAGG + Intergenic
1070722943 10:78769279-78769301 TGTGTGTGTCCCTGGGCACTTGG + Intergenic
1072571788 10:96664599-96664621 TTTGTGTCAAGCTGGGCTCTTGG - Intronic
1073207539 10:101776615-101776637 TGTGTGTCCCGCCGGGCCCCTGG + Intronic
1074188906 10:111118886-111118908 TGCCTGTGCCGCTGGTCTCTGGG - Intergenic
1076202279 10:128568104-128568126 TGTCTGTAGCTCTGGGCTCCTGG + Intergenic
1076871115 10:133195619-133195641 AGTGTCTACCGCAGGGCTGTGGG - Intronic
1076915668 10:133422148-133422170 TGGGTGTCCTGCTGGGCGCTGGG + Exonic
1077106674 11:845270-845292 TGTGTGCACCGCTGAGGTGTCGG - Intronic
1077153738 11:1082481-1082503 TGTCTGTAACGCTGGCCGCTGGG + Intergenic
1080443358 11:32315129-32315151 TGTGTCTACCCCTGGATTCTTGG - Intergenic
1080615954 11:33944956-33944978 TGTGTGAACATCTGGGATCTGGG + Intergenic
1083872932 11:65501628-65501650 GGAGTGTACCGCTGTGCTGTTGG + Intergenic
1084185214 11:67467834-67467856 GGTGAGTACAGCTGGGCACTAGG + Intronic
1084905176 11:72340478-72340500 TCTGTGTACAGCTGGGCATTAGG + Intronic
1085303228 11:75470997-75471019 TGAGGGTGCAGCTGGGCTCTGGG - Intronic
1087261108 11:96013606-96013628 TGTGTCTACTGCTAGGGTCTGGG - Intronic
1087349982 11:97019504-97019526 TGTGGCCACCGCTGGGCTATGGG - Intergenic
1090520782 11:127476709-127476731 TGTCTCTACCCCTGGCCTCTGGG + Intergenic
1094524969 12:31225467-31225489 GGTGTGCAGAGCTGGGCTCTTGG - Intergenic
1100605544 12:96149374-96149396 TGTGTGTACCTCGCTGCTCTAGG - Intergenic
1101876079 12:108597745-108597767 TGTGTGTGCGGCTGGGGCCTTGG - Intronic
1103234727 12:119361596-119361618 TGTGGGTAACCCTGGTCTCTGGG - Intronic
1104411331 12:128560443-128560465 TGTTTCTACCCCAGGGCTCTTGG + Intronic
1111643790 13:91004540-91004562 TGTGTGGACCTTTGGGCTCTAGG - Intergenic
1112043643 13:95573736-95573758 TGTGTGTACCTCTAAGTTCTAGG + Intronic
1115459268 14:33641508-33641530 TGTGTGTACCACTAGGGGCTAGG + Intronic
1118685098 14:68283171-68283193 CATGTGTACTCCTGGGCTCTGGG - Intronic
1118807787 14:69252795-69252817 TGTCTGTCCTGCTGGGCTCCGGG + Intergenic
1121254349 14:92520310-92520332 TGTGTGTAGAGCCAGGCTCTGGG - Intronic
1122842541 14:104473383-104473405 TGTGTGGGCTGCTGGGCCCTTGG + Intergenic
1124355601 15:28992760-28992782 TGTGTGTCCCTCTGGGCTGCAGG + Intronic
1127006617 15:54577740-54577762 TGAGGGTTTCGCTGGGCTCTAGG - Intronic
1129473363 15:75767161-75767183 TGTGGGTAGCTCTGGGCTCCAGG - Intergenic
1129688044 15:77697431-77697453 TGTGTGTCCTACTGGGCTCTAGG - Intronic
1130175183 15:81561516-81561538 TGTGTGTGCTGCTGTGCTTTGGG - Intergenic
1131439559 15:92448603-92448625 TGTGTCTTCTGCGGGGCTCTGGG - Intronic
1132431915 15:101767509-101767531 AGTGTGTCCAGCTGGGCTGTTGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG + Intronic
1134881473 16:17748205-17748227 GGCGTGCACCGCAGGGCTCTTGG - Intergenic
1141629302 16:85277944-85277966 TGTGCGCACCCATGGGCTCTAGG - Intergenic
1141937209 16:87248741-87248763 TGTGTGTGTTGCTGTGCTCTTGG - Intronic
1142033043 16:87847877-87847899 CGTGTGTGCCACTGGGCTGTGGG - Intronic
1145011031 17:19367997-19368019 TGTGGGTAGGGCTGGGCCCTCGG + Intronic
1147875392 17:43617150-43617172 TGTGTGCACCTCTGGGCTGAGGG + Intergenic
1149162454 17:53710551-53710573 TGGGTGTACTCCTGGGGTCTGGG + Intergenic
1150314161 17:64154867-64154889 TGTCTCCCCCGCTGGGCTCTGGG + Exonic
1151003485 17:70405675-70405697 TGTCTTTACCTCTGGGCCCTGGG - Intergenic
1153988694 18:10376161-10376183 TTTGTGTACCACTGAGCTTTGGG - Intergenic
1159879193 18:73842353-73842375 TGTGTGTTCCACTGGGCTCCTGG + Intergenic
1162440804 19:10690971-10690993 TGTGTGCGCTGCTGGGATCTCGG - Exonic
1165079199 19:33298146-33298168 TGTGTTCAGTGCTGGGCTCTTGG + Intergenic
1165420987 19:35721816-35721838 TGGGTGTGCCGCTGGGCCCAGGG - Intronic
1165559484 19:36666901-36666923 GGTGTGTTCCGCCGGGCTCCGGG + Intergenic
1168578637 19:57535013-57535035 GGTGTCTCCCACTGGGCTCTGGG - Intronic
1168719678 19:58548180-58548202 GGTGTGTACTGGTGGGCTCCTGG + Exonic
925892567 2:8447660-8447682 TGTGGGGACCCCTGGGCTCTGGG - Intergenic
926706376 2:15840617-15840639 TGTGTGGAACTCTGGGCACTAGG - Intergenic
927097786 2:19760814-19760836 TGTGTCTACAGCTCTGCTCTTGG - Intergenic
927297222 2:21468461-21468483 TCTGTGTAACGCTGGACACTTGG - Intergenic
930878904 2:56249797-56249819 TGTGTCTACACCTGGGCCCTGGG + Intronic
932614887 2:73225718-73225740 TGGTTGTGCAGCTGGGCTCTGGG + Intronic
936374212 2:111927012-111927034 TGTCTGGACAGCTGGGCTCCAGG + Intronic
937301025 2:120841882-120841904 TGTGTGTGATGCTGGGCTCTGGG + Intronic
938066216 2:128283331-128283353 TGTGAGCACTGCTGAGCTCTGGG - Intronic
1170549129 20:17461013-17461035 TGCCTGTTCCACTGGGCTCTCGG + Intronic
1170875873 20:20249489-20249511 TGATTGTACCACTGTGCTCTAGG + Intronic
1171370310 20:24658266-24658288 TGTCTGAAGTGCTGGGCTCTGGG - Intronic
1172619452 20:36309420-36309442 TGAGTGGAGGGCTGGGCTCTGGG + Intronic
1172962879 20:38810954-38810976 TTTGTGTACCTTTGGGCGCTGGG + Intronic
1173039916 20:39452564-39452586 TGTGTGTGCCTCTGGGATCTGGG - Intergenic
1173727977 20:45309992-45310014 TGTGGGTACTGCTGGGCACTGGG + Intronic
1181608407 22:23995029-23995051 AGTCTGTCCCTCTGGGCTCTGGG + Intergenic
1181711403 22:24694184-24694206 GGTGTGTACCCCTGGGGGCTCGG + Intergenic
1182152996 22:28043600-28043622 TGTGGGAACCCCTGGGCTGTGGG - Intronic
1184088787 22:42281812-42281834 GGTGTGTTCCTCTGAGCTCTAGG + Intronic
1184403946 22:44289491-44289513 TGTGTTTACTGCCGGGCTCCTGG + Intronic
1184651723 22:45922395-45922417 TGGGTCTGCCGCTGGGCCCTGGG - Exonic
952990056 3:38823950-38823972 TGGGTGTCCTGCTGGGCCCTGGG + Intergenic
961537076 3:127576797-127576819 TGTGTGTACCGCTGGGCTCTTGG - Intronic
966633553 3:182106614-182106636 CATGTGTAGAGCTGGGCTCTTGG - Intergenic
967174106 3:186847010-186847032 TCTGTGTAGCTCTGGGATCTTGG + Intronic
968107238 3:196009667-196009689 TGTGTGCACCGCCAGGGTCTAGG - Intergenic
969897677 4:10320544-10320566 AGTCTGTTCCCCTGGGCTCTAGG + Intergenic
974339441 4:60596059-60596081 TGTGAGTAGTGCTGGGCTGTGGG - Intergenic
979372299 4:119903696-119903718 TCAGTTTAGCGCTGGGCTCTTGG - Intergenic
980051778 4:128046970-128046992 TGTTTCTCCCGGTGGGCTCTTGG + Intergenic
984527126 4:180870864-180870886 TGTGTTTACCTTTGGGTTCTTGG + Intergenic
985411466 4:189690027-189690049 ACTGTGTACATCTGGGCTCTTGG - Intergenic
986047571 5:4054331-4054353 TGTGTGTACTCTTGGCCTCTTGG + Intergenic
986455082 5:7910436-7910458 TGTGTTTTGAGCTGGGCTCTGGG + Intergenic
986762393 5:10892378-10892400 TGTATGAACAGCTGGGTTCTTGG - Intergenic
988066625 5:26233312-26233334 TGTGTGCACCGCCAGGGTCTAGG - Intergenic
997660619 5:135586739-135586761 TGTGTGTAGGGCAGGGATCTGGG + Intergenic
998617657 5:143758312-143758334 TGTGTGTGCTGCTCGGCACTGGG - Intergenic
1001209260 5:169795012-169795034 TGTGTGTAGGGATGGGGTCTTGG - Intronic
1004541608 6:16555526-16555548 TGTAGGAACCACTGGGCTCTGGG - Intronic
1006033870 6:31197161-31197183 TCTGTGAACCGCAGCGCTCTGGG + Intergenic
1008473838 6:51914983-51915005 TGTGTGTACATCTGGGATTTAGG + Intronic
1012474894 6:99607450-99607472 TGTGTTTTCCCCTGCGCTCTCGG + Intronic
1014381133 6:120743678-120743700 TTTGGGTACCCCTCGGCTCTTGG + Intergenic
1019400858 7:852694-852716 TGTGTGTACCGCTTAGCCATCGG - Intronic
1026828163 7:73596630-73596652 TCTCTTTACCGCTGGGCGCTGGG + Exonic
1035233477 7:157480941-157480963 TGTGTGCTCTGCTGGGATCTGGG + Intergenic
1035514840 8:223857-223879 GGAGTGTAGCGCTGTGCTCTTGG - Intergenic
1036294923 8:7528084-7528106 TGTTTGCACCTCTGGGCCCTGGG + Intergenic
1036296558 8:7542665-7542687 TGTTTGCACCTCTGGGCCCTGGG + Intergenic
1036326008 8:7778354-7778376 TGTTTGCACCTCTGGGCCCTGGG - Intergenic
1036327640 8:7792907-7792929 TGTTTGCACCTCTGGGCCCTGGG - Intergenic
1042336116 8:67631250-67631272 TGTGTCTACCTCTGGGTTTTTGG + Intronic
1048634936 8:136285500-136285522 TGTGTGGACCTTTGGACTCTGGG - Intergenic
1056780669 9:89547833-89547855 TGTGTGTGCCACTGGGCTTTTGG + Intergenic
1058858273 9:109088226-109088248 TGTGTGTAACACTGAGCTCATGG - Intronic
1059316593 9:113430787-113430809 TGTGTGTGCTGCTGGGTTCAAGG + Intergenic
1059331303 9:113537387-113537409 AGTGTGGACTGCTGGGGTCTGGG + Intronic
1060817556 9:126643139-126643161 TGTGTGCACAGCTGGGGGCTAGG + Intronic
1061403866 9:130383096-130383118 TGTGTGCGGTGCTGGGCTCTGGG - Intronic
1203671129 Un_KI270755v1:12955-12977 ACTGTGTACATCTGGGCTCTTGG + Intergenic
1195410604 X:104565394-104565416 AGAGTGTTTCGCTGGGCTCTCGG - Intergenic
1199605627 X:149576683-149576705 TGTCTGTTCTGCTGGGGTCTGGG + Intergenic
1199633494 X:149792685-149792707 TGTCTGTTCTGCTGGGGTCTGGG - Intergenic