ID: 961537076

View in Genome Browser
Species Human (GRCh38)
Location 3:127576797-127576819
Sequence TGTGTGTACCGCTGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961537076_961537086 17 Left 961537076 3:127576797-127576819 CCAAGAGCCCAGCGGTACACACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 961537086 3:127576837-127576859 GATGATCACACTCAGCTCGATGG 0: 1
1: 0
2: 0
3: 3
4: 71
961537076_961537081 -5 Left 961537076 3:127576797-127576819 CCAAGAGCCCAGCGGTACACACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 961537081 3:127576815-127576837 ACACACCAAAGGCCAGGCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 310
961537076_961537087 25 Left 961537076 3:127576797-127576819 CCAAGAGCCCAGCGGTACACACA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 961537087 3:127576845-127576867 CACTCAGCTCGATGGCCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961537076 Original CRISPR TGTGTGTACCGCTGGGCTCT TGG (reversed) Intronic