ID: 961538816

View in Genome Browser
Species Human (GRCh38)
Location 3:127586820-127586842
Sequence CTTGAGGCACAGAGGCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961538807_961538816 6 Left 961538807 3:127586791-127586813 CCAGCAGTCACCAGCAAGCTGAG 0: 1
1: 0
2: 4
3: 24
4: 223
Right 961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG 0: 1
1: 0
2: 0
3: 32
4: 258
961538809_961538816 -4 Left 961538809 3:127586801-127586823 CCAGCAAGCTGAGAGGCCCCTTG 0: 1
1: 0
2: 1
3: 10
4: 155
Right 961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG 0: 1
1: 0
2: 0
3: 32
4: 258
961538805_961538816 14 Left 961538805 3:127586783-127586805 CCAGGCACCCAGCAGTCACCAGC 0: 1
1: 0
2: 2
3: 88
4: 441
Right 961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG 0: 1
1: 0
2: 0
3: 32
4: 258
961538804_961538816 26 Left 961538804 3:127586771-127586793 CCAGGGTGCAGGCCAGGCACCCA 0: 1
1: 0
2: 4
3: 42
4: 434
Right 961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG 0: 1
1: 0
2: 0
3: 32
4: 258
961538806_961538816 7 Left 961538806 3:127586790-127586812 CCCAGCAGTCACCAGCAAGCTGA 0: 1
1: 0
2: 1
3: 15
4: 168
Right 961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG 0: 1
1: 0
2: 0
3: 32
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961538816 Original CRISPR CTTGAGGCACAGAGGCCAGT GGG Intronic
900358815 1:2278187-2278209 GGTGGGGCACAGAGACCAGTGGG - Intronic
900536262 1:3179240-3179262 GGTGAGGCAGAGAGGCCAGCAGG + Intronic
900656681 1:3762185-3762207 CTTGAGGCATTTAGGGCAGTTGG - Intronic
900969798 1:5985290-5985312 CGTGAGGCCCAGTGGCCGGTGGG - Intronic
902043536 1:13509449-13509471 TTTGAGAAACCGAGGCCAGTGGG - Intronic
904306338 1:29592637-29592659 CTTGATGCTCAGATGCCAGCAGG - Intergenic
904441372 1:30534154-30534176 GTTAAAGCACAGTGGCCAGTGGG - Intergenic
904456439 1:30651050-30651072 CTGGAGACAAAGAGGCCACTTGG + Intergenic
904475652 1:30763116-30763138 CTGGAGGCACAGAAGCCATTTGG + Intergenic
904568604 1:31443787-31443809 CTTCAGGGAGAGAGGACAGTGGG - Intergenic
905591086 1:39164409-39164431 CTTCAGGCTTAGTGGCCAGTTGG + Intronic
905629804 1:39512167-39512189 CCTCAGGCACTGAGGCCAGGAGG + Intronic
905667955 1:39774023-39774045 CCTCAGGCACTGAGGCCAGGAGG - Intronic
905894999 1:41539966-41539988 ATTGAGGCAGAAAGGCCAGTTGG + Intronic
907951766 1:59190011-59190033 TTTGAGGCAAAGAGGACAGAAGG - Intergenic
908469858 1:64433129-64433151 CTTGAATCACCGAGGCCAGGAGG + Intergenic
910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG + Intergenic
911593284 1:99772085-99772107 TTTGGGACACAGAGGCAAGTGGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913318309 1:117571427-117571449 GTGGAGGCACAGAAGCTAGTAGG + Intergenic
916579200 1:166092529-166092551 CTTGAGGCTTAAAGACCAGTAGG - Intronic
916649484 1:166821548-166821570 CCTGAGGGAAAGAGGCCATTTGG - Intergenic
919280955 1:195487579-195487601 CTAGAGGCAAAGAGACAAGTTGG + Intergenic
920199088 1:204248433-204248455 CGTGAGCCACTGAGGCCAGCTGG + Intronic
920715768 1:208338591-208338613 ATTGTGGCACAGAGGCCATCTGG + Intergenic
922717815 1:227886325-227886347 CTTGAGGCCAAGGGGACAGTGGG + Intergenic
922880081 1:228974250-228974272 ACTGAGGCACAGAGGTCACTTGG - Intergenic
924419902 1:243898114-243898136 CCTGAGCCACATAGGCCAGGTGG - Intergenic
1062894023 10:1089312-1089334 CTCAAGGCACAGAGACCAGCCGG - Intronic
1063962749 10:11320520-11320542 ATTGAGGCACAGAAGCCATGTGG - Intronic
1064023142 10:11825300-11825322 CCGGTGGCACAGAGGCCATTCGG + Intronic
1066024516 10:31341197-31341219 TTGGAGGCAGAGAGGCCATTTGG + Intronic
1068797524 10:61100389-61100411 CTTCAGTCTCAGAGGCCAGTGGG - Intergenic
1069708676 10:70475379-70475401 CCTGAGGCTCAGAGACCACTGGG + Intergenic
1070830181 10:79413352-79413374 CATCAGGCTCAGAGGCCAGGAGG - Intronic
1071466599 10:85946600-85946622 CTTGAGTAACAGAGTCCAGTGGG + Intronic
1071699347 10:87913403-87913425 CTTGAAGGACAGAAGGCAGTGGG - Intronic
1072035575 10:91560460-91560482 CTGGAGGCAGGGAGGCCAGCTGG - Intergenic
1073517923 10:104094693-104094715 CTTGAGAGACTGAGGCCAGAGGG - Intergenic
1074035610 10:109735275-109735297 CATGGGGCATCGAGGCCAGTAGG - Intergenic
1074684651 10:115949580-115949602 CTTGAGGCCCTGAGCCCAGAAGG - Intergenic
1075589760 10:123683188-123683210 CCTGAGTCAAGGAGGCCAGTGGG + Intronic
1076809115 10:132877660-132877682 ACTGAGGCACAGAGGCCAGCCGG + Intronic
1077300103 11:1842822-1842844 CTTGAGGGACTGACGTCAGTGGG + Intergenic
1079135526 11:17774245-17774267 CTAGAGGCCCAGAGCCCTGTTGG - Intronic
1080238527 11:30099650-30099672 CTTGAGGACCAGAGCCCAGAAGG - Intergenic
1082075632 11:47973941-47973963 GCTGGGGCACAGAGGCCAGTGGG + Intergenic
1082916598 11:58444713-58444735 CTTTTGGCACAGTGTCCAGTGGG - Intergenic
1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG + Intronic
1085970096 11:81578799-81578821 ATTGCAGCACAGAGGCCAGTTGG + Intergenic
1086335828 11:85799822-85799844 TTTTAGGCTCAGAGTCCAGTGGG - Intronic
1088783904 11:113163603-113163625 CTTGTCTCAGAGAGGCCAGTAGG + Intronic
1091150557 11:133324580-133324602 CCTGGGGCACAGAGGCCCGTAGG - Intronic
1098138159 12:67424916-67424938 CCTGAGGCAGACAAGCCAGTTGG - Intergenic
1102047712 12:109840219-109840241 CCTGAGGCACACAGGACAGTGGG - Intergenic
1102889216 12:116545301-116545323 CTTGAGGCTGAGAGGCCCTTGGG - Intergenic
1103415488 12:120739644-120739666 CTTGAGGCACAGTGGTGAGGAGG - Exonic
1103611431 12:122126545-122126567 CTGCAGGCACTCAGGCCAGTGGG + Intronic
1105708070 13:22981183-22981205 ATTGAGGCTAAGAGGCCAGTGGG - Intergenic
1105923334 13:24984905-24984927 CCTGAGGCTCAGAGGCCGGCTGG + Intergenic
1107635963 13:42392856-42392878 TTGGAGGCACAGAGGCCTGATGG + Intergenic
1110148423 13:72221697-72221719 CTCGGGGCTCAGAGGCCTGTGGG + Intergenic
1110827452 13:79989277-79989299 CTTGAGGCAAAGTTGTCAGTTGG - Intergenic
1111951191 13:94711062-94711084 GTAGAGGCAGAGAGGCCAGGCGG - Exonic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1113573818 13:111380655-111380677 CTTCAGGGAGAGGGGCCAGTGGG - Intergenic
1114703818 14:24705906-24705928 CTTGAGCCCCAGGGGCCTGTGGG + Intergenic
1115406347 14:33021336-33021358 ATTGAGACACAGAGGGCAGTTGG + Intronic
1118913494 14:70081521-70081543 ATGGAGGCCCAGAGGGCAGTTGG - Intronic
1120813518 14:88829105-88829127 GGTGAGGGACAGAGGCCAGCCGG + Intronic
1121007522 14:90499864-90499886 CTTGTGGCCCTGAGGCCTGTGGG - Intergenic
1121247293 14:92471231-92471253 CTGGAGTTGCAGAGGCCAGTGGG - Intronic
1122126438 14:99581070-99581092 CTGGAGGCAGGGAGGCCAGCTGG + Intronic
1122199520 14:100114013-100114035 GCGGAGGCAGAGAGGCCAGTTGG + Intronic
1122224318 14:100264828-100264850 CTTGAGCCACAGAGCCCAGCTGG - Intronic
1122273936 14:100581575-100581597 CCTGATGCACAGAGGCGGGTGGG - Intronic
1122288882 14:100668846-100668868 CCTGAGGCAGAGAGGCAGGTGGG - Intergenic
1122736845 14:103848032-103848054 GCTGCGGCCCAGAGGCCAGTGGG + Intergenic
1123070921 14:105642153-105642175 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123090586 14:105740437-105740459 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123096216 14:105768187-105768209 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1124413172 15:29453221-29453243 CTTAAGCCTCAGAGGCCGGTAGG + Intronic
1127322109 15:57856822-57856844 CTTGAGGAAAAGGGGCCTGTTGG + Intergenic
1128092236 15:64926815-64926837 GTTGGGGAACAGAGGCCAGGTGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1132387537 15:101411113-101411135 CTTGAGGCACTGAGGAAAGACGG + Intronic
1132647088 16:1004044-1004066 CATGAAGCACATAGGGCAGTGGG + Intergenic
1133113810 16:3564758-3564780 TCTGCGGGACAGAGGCCAGTGGG + Exonic
1133174388 16:4002995-4003017 CATGAGCCACTGAGCCCAGTTGG + Intronic
1133281423 16:4667538-4667560 CTTGAAGTACAGAACCCAGTGGG + Intronic
1133718196 16:8469515-8469537 CTGGAGGCAGAGAGGCAGGTGGG - Intergenic
1135630612 16:24033222-24033244 CCTGAGGCCCAGAGGACAGAGGG + Intronic
1138417077 16:56877757-56877779 CCTGCGCCACAGAGGCCACTTGG - Intronic
1138430531 16:56965777-56965799 CTGCAGGCAGGGAGGCCAGTGGG - Intronic
1139327318 16:66162507-66162529 ATTGAGGCATAGAGGCTAGTTGG - Intergenic
1139594093 16:67948159-67948181 CCTGCGGCACAGAGGGCGGTTGG + Exonic
1141152645 16:81574760-81574782 CGGGAGGCTCACAGGCCAGTAGG + Intronic
1142228393 16:88888423-88888445 CTTCAGACACAGAGTGCAGTGGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143556949 17:7667963-7667985 CTGGATGGAGAGAGGCCAGTGGG - Intronic
1146300445 17:31685200-31685222 CCTGAGGCACACAGACCACTTGG + Intergenic
1146782235 17:35684757-35684779 CTTGAGGCTCTGTGGCCAATGGG - Intronic
1147136976 17:38440007-38440029 CTTGAGCTACCGAGCCCAGTCGG + Intronic
1147722484 17:42547562-42547584 CCTGAGGCGCAGCGGCCAGGGGG - Intergenic
1147723674 17:42553750-42553772 CCTGAGGCGCAGCGGCCAGGGGG - Intronic
1148988074 17:51640989-51641011 GGTGAAGCTCAGAGGCCAGTGGG + Intronic
1149529948 17:57387090-57387112 ATTGAGGCAAAGAGGCAACTGGG - Intronic
1150900957 17:69276366-69276388 CTTGAGCCACCGAGCCCAGATGG + Intronic
1151523306 17:74646478-74646500 CTTGAGGCTTATAGCCCAGTAGG - Intergenic
1152071428 17:78135662-78135684 CGTGAGGGAGAGAAGCCAGTGGG - Intronic
1152330499 17:79669929-79669951 CTTGGGTCACAGTGGCCAGTGGG + Intergenic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1153994193 18:10425587-10425609 CTCAATGCACAGGGGCCAGTGGG - Intergenic
1154498378 18:14979180-14979202 CTAGAGGCAGAGCGGCCTGTTGG + Intergenic
1155536861 18:26827763-26827785 CTTGAGGCTCAGAGGGGAATAGG + Intergenic
1156397939 18:36716196-36716218 CTAGAAGCAGAGAGTCCAGTGGG + Intronic
1158496503 18:57959892-57959914 TTGGAGGCACAGAAGCCAGGTGG + Intergenic
1159923304 18:74246160-74246182 CTGAAGGCACAGAGTCCAGTAGG - Intergenic
1161727173 19:5936249-5936271 CCTGATGCACAGAGGACAGAGGG + Intronic
1163815310 19:19461498-19461520 CCTGAGGCTCTCAGGCCAGTTGG + Intronic
1165316822 19:35060844-35060866 CTTGAGGACCCGAGGCCAGGAGG + Intronic
1166748885 19:45155421-45155443 TGGGTGGCACAGAGGCCAGTAGG + Intronic
1166981209 19:46633365-46633387 CTTGGGGCTCAGAGTCCAGTAGG - Intergenic
1166991095 19:46693237-46693259 CATGGGGCTCAGAGTCCAGTAGG - Intronic
1167569943 19:50280644-50280666 CTGGAGGCCCAGAGGCCAAGAGG - Intronic
1168240959 19:55088712-55088734 CTTGAGGCCCAGAGGCCCAGAGG - Intergenic
926207104 2:10841592-10841614 CCTGTGGCACAGCTGCCAGTGGG - Intergenic
927458388 2:23276892-23276914 CTGGAGGCAAGGAAGCCAGTAGG + Intergenic
929932999 2:46273160-46273182 CTTGAGGCCCAGAGGCACATGGG + Intergenic
931684883 2:64784597-64784619 GTTGAAGCAGGGAGGCCAGTGGG + Intergenic
936147159 2:109987598-109987620 CTGTAGTCAGAGAGGCCAGTGGG + Intergenic
936197533 2:110383885-110383907 CTGTAGTCAGAGAGGCCAGTGGG - Intergenic
937451360 2:122004499-122004521 CTTGAGGAAGAGGGGCCAGAAGG - Intergenic
938422797 2:131157422-131157444 CATGAGGCACCGCGGGCAGTCGG + Intronic
940335005 2:152517429-152517451 CTTGAAGCACTCAGTCCAGTGGG + Intronic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
944052124 2:195481721-195481743 TTTGAGCCACAGGGGCAAGTCGG - Intergenic
944657564 2:201891305-201891327 CGTGAGGCACAGTGCCCAGCTGG + Intronic
947081516 2:226402377-226402399 ATTGAGGCACAGAGGGCTTTAGG - Intergenic
948368108 2:237471795-237471817 CTGGAGCCACAGAGGCCTGCAGG + Intergenic
948526243 2:238572610-238572632 CTTGAGGCAGGCAGGCTAGTGGG - Intergenic
1168792907 20:591977-591999 CAGGAGGCAGGGAGGCCAGTTGG - Intergenic
1168859198 20:1033703-1033725 CTTGGGGCACAGATACCATTAGG + Intergenic
1173000212 20:39099976-39099998 CATGCAGCACAGAGCCCAGTGGG - Intergenic
1173562782 20:44018102-44018124 CTTGGGGGCCAGAGGACAGTGGG + Intronic
1173925126 20:46775337-46775359 CCTGAGGCTGCGAGGCCAGTTGG + Intergenic
1174447218 20:50598206-50598228 CACGAGGCTCAGAGGCCTGTGGG + Intronic
1174862614 20:54105354-54105376 ACTGAGGCCCAGAGGCCAGTGGG - Intergenic
1175814259 20:61875315-61875337 ATGGGGGCAGAGAGGCCAGTTGG + Intronic
1176109531 20:63405101-63405123 CCTGAGGCCCTGAGGCCAGCAGG - Intergenic
1176216374 20:63949886-63949908 CTTGAGGGACAGACACCAGACGG + Intronic
1176309567 21:5142491-5142513 CCCCAGGCACAGAGGCCAATGGG + Intronic
1178327238 21:31655811-31655833 CTCAAGGCAGAGAGGCCATTTGG - Intergenic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1178713414 21:34941208-34941230 CTGGAGGCACAGAGGCTAAAGGG - Intronic
1178842501 21:36149056-36149078 CTTGAGCCACTGTGGCCAGCCGG - Intergenic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1179939046 21:44626615-44626637 CAGGAGGCACAGAGGCCATGGGG + Intronic
1179996262 21:44975830-44975852 CCAGAGCCACAGAGGACAGTGGG - Intronic
1180083027 21:45495124-45495146 CTGGAGGCAGACAGGGCAGTGGG + Intronic
1180090953 21:45533631-45533653 CTGGAGGCCCAGAGTCCAGCAGG - Intronic
1180225071 21:46387379-46387401 CGAGGGGCACAGCGGCCAGTGGG + Intronic
1180229830 21:46420589-46420611 CTGAAGGCACAGGGTCCAGTGGG + Intronic
1181459288 22:23076795-23076817 CTTGGGGCACAGGGGCCACCTGG - Intronic
1181690700 22:24557985-24558007 CTTGAGGCAGAAAAGCCATTTGG + Intronic
1182067197 22:27438961-27438983 CTTGAGGCAAAGAGGGGAGGTGG + Intergenic
1182084169 22:27550158-27550180 CGGGAGGCAGGGAGGCCAGTGGG + Intergenic
1182528122 22:30934339-30934361 CTTATGGCGCAGGGGCCAGTGGG - Intronic
1183971699 22:41482275-41482297 CTTCAGGCCCAGCGGCCAGGTGG - Intronic
1184251035 22:43260470-43260492 CTTGAGCCACAGAGGCTGCTTGG + Intronic
1184335901 22:43852941-43852963 CCAGGGCCACAGAGGCCAGTGGG + Intronic
950038393 3:9903375-9903397 CCTGAGGCACAGGGCCCAGTAGG - Exonic
950097048 3:10336539-10336561 CTAGTGGCTCAGGGGCCAGTGGG + Intronic
950582380 3:13871032-13871054 CTTCAGTCACAGAGTCCAGCTGG + Intronic
953403908 3:42650950-42650972 CTGGAGGCATTGAGGTCAGTGGG - Intergenic
953575135 3:44107217-44107239 CCTGGGCCACAGAGGCCAGAGGG + Intergenic
955660828 3:61297216-61297238 CTAGAGGCACAGAAGACAATGGG - Intergenic
961233300 3:125340365-125340387 CTAGAGACAGAGAGGCAAGTAGG + Intronic
961465596 3:127079072-127079094 GTGGAGGCAGAGAGGCCAGTAGG - Intergenic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
964249029 3:154688922-154688944 CATGATGCTCAGAGGCTAGTGGG + Intergenic
964939507 3:162138678-162138700 TTCCAGGCACATAGGCCAGTCGG + Intergenic
965558490 3:170040002-170040024 CTTCAGGCACGGGGGCCTGTCGG + Intronic
966202400 3:177370660-177370682 CTGGAAGCACAGGGACCAGTTGG - Intergenic
966227684 3:177615630-177615652 CTTGAGCCCAAGAGGCCAGGAGG - Intergenic
966918398 3:184597280-184597302 CTTGAGGCCCAGAGGCCCAAAGG - Intronic
966991217 3:185232797-185232819 CCTCAGCCACAGAGGCCAGAAGG + Intronic
967167033 3:186790467-186790489 CTGGGGGCACGGGGGCCAGTTGG - Intronic
968011228 3:195278910-195278932 CTTGAGGCAGGCAGGACAGTTGG + Exonic
968273786 3:197424574-197424596 CTAGAGACACAGAGGCCCGGGGG - Intergenic
968754424 4:2408106-2408128 CTTGAGGCCTGGAGGCCAGGGGG - Intronic
972026953 4:34392809-34392831 TATGAGGCAAAGTGGCCAGTTGG - Intergenic
973240471 4:47950974-47950996 CTTAAGGGACAGACCCCAGTGGG + Intronic
975794675 4:77994655-77994677 CTTGATACACAGATGCAAGTTGG + Intergenic
978363130 4:107951931-107951953 CTTTAGTCACAGAGACCAGTAGG - Exonic
979069375 4:116182367-116182389 CTTGAGCCACCGTGCCCAGTCGG - Intergenic
980108811 4:128614992-128615014 CTTGGGGCTCAGAAGCCTGTGGG - Intergenic
980485769 4:133456080-133456102 CTGAAAGCACAGAGGCCAGGTGG + Intergenic
985638209 5:1050646-1050668 CTAGAGGCACAGCGGCCACATGG - Exonic
986126400 5:4886157-4886179 CCTGAAGCACAGAGTCCAGCAGG + Intergenic
987234694 5:15930886-15930908 GTTGATGCAGAGAGGCCAGAGGG + Intronic
988425436 5:31058072-31058094 CTTGGGGGACAGATGCCAGAAGG + Intergenic
989159344 5:38375462-38375484 CTTGAGGCTAAGTGCCCAGTGGG + Intronic
989526366 5:42457895-42457917 ACTGAGGCAGAGAGGCTAGTAGG - Intronic
991285705 5:64973358-64973380 CCAGAGGCACAGGGCCCAGTTGG + Intronic
993771281 5:91931151-91931173 CTTATGCCACAGGGGCCAGTGGG - Intergenic
993835438 5:92814132-92814154 CATGAGGCATGGAGGCCATTTGG - Intergenic
998153076 5:139768294-139768316 CTCCAGGCTGAGAGGCCAGTGGG + Intergenic
1000835765 5:166151739-166151761 CATGAGCCACAGAGCCCAGTGGG + Intergenic
1002323332 5:178388691-178388713 CTGGAGGCAGGGAGGCCACTCGG - Intronic
1002661910 5:180797124-180797146 CTTGAGCCACCAAGCCCAGTGGG - Intronic
1003731640 6:8830963-8830985 CTGGAGGTACTGTGGCCAGTAGG + Intergenic
1004310612 6:14541655-14541677 CTTGAGGGTCAGAGGCATGTGGG + Intergenic
1004970605 6:20905754-20905776 CTTGGAGCCCAGAAGCCAGTGGG + Intronic
1005699709 6:28388183-28388205 CATGAGGCACTGAGGCAACTGGG - Intronic
1006164076 6:32054245-32054267 CTGGAGGCAGGGAGGCCAGTAGG - Intronic
1006164702 6:32057443-32057465 CTGGAGGCAGCGAGGCCAGTAGG - Intronic
1006831518 6:36970938-36970960 CTTGAGGCTCACAGTCCGGTGGG - Intronic
1007218002 6:40256183-40256205 ATTCAGGCACAGAGGAAAGTGGG + Intergenic
1007362355 6:41368026-41368048 CTTGAGCCACTGAGCCCAGCTGG - Intergenic
1016486832 6:144549769-144549791 CAGGAGGCACAAAGGACAGTAGG + Intronic
1017679070 6:156845556-156845578 CTAGAAGCTCAGAGGACAGTGGG - Intronic
1018112078 6:160545826-160545848 CTAGAGCCTCAGAGGACAGTGGG + Intronic
1018565000 6:165142071-165142093 CTAGAGGCAGGGAGGCCAGGAGG + Intergenic
1018762531 6:166904338-166904360 CTGGAGGAACACCGGCCAGTGGG + Intronic
1019369025 7:651194-651216 CTTGAGGGCCAGAGGCCCCTAGG - Intronic
1019950842 7:4371017-4371039 CTAGAGGCACAGCGACCACTAGG - Intergenic
1021465518 7:20938654-20938676 CTTGAGGCACAGAAGCAAAATGG + Intergenic
1022371633 7:29777072-29777094 GTGGAGGCAGAGAGACCAGTTGG + Intergenic
1023137466 7:37066523-37066545 TTTGAGGCACAGAGGCCTACTGG - Intronic
1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG + Intronic
1023906474 7:44525836-44525858 CTTGAAGCCCAGATGGCAGTGGG + Intronic
1025092840 7:56077784-56077806 CTTGAGGCACTGTGGCATGTGGG + Intronic
1030333719 7:108300607-108300629 GTTGAGGCACATAGGCTAGGTGG + Intronic
1031974700 7:128086284-128086306 CTTGAGGAACAGCAGCCAGCTGG + Intronic
1031989655 7:128189387-128189409 CTGGAGGCACAGGGCCCAGGAGG + Intergenic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1035560822 8:602418-602440 GCTGAGCCACAGAGACCAGTAGG + Intergenic
1037374055 8:18209632-18209654 CTTCAGGTAGAGAGGCCAGTGGG + Intronic
1037990645 8:23319416-23319438 CATTAGGCACAGATGCCAGCGGG + Intronic
1038104204 8:24414964-24414986 CTGTGGGCACAGAGGCCTGTGGG - Intergenic
1038647137 8:29371409-29371431 CTAGAGGCAGAGAGACCAGTAGG + Intergenic
1038954539 8:32452925-32452947 CTTGAGACAAAGAGGTCAGTAGG + Intronic
1039105097 8:33981721-33981743 CTTGATGCACAAAGTCCAGAGGG + Intergenic
1043502417 8:80871145-80871167 GTAGAGGCAGGGAGGCCAGTTGG - Intronic
1046104498 8:109649421-109649443 CTTGGGGCAGAGAGGGCAGTGGG + Intronic
1046910551 8:119621654-119621676 CTTGAGGCCCAGAGGACATTTGG + Intronic
1047263522 8:123283485-123283507 CATGAGCCACTGAGTCCAGTTGG - Intergenic
1047414086 8:124649620-124649642 CTTGAGTAACAGTGGTCAGTAGG - Intronic
1048444783 8:134485236-134485258 CATCAGGCTCAGAGGCCAGGCGG - Intronic
1049090547 8:140511011-140511033 CTTGAAGCACAAAGTCCAGGGGG - Intergenic
1049325643 8:142020165-142020187 CTTGGGGCCCAGGTGCCAGTTGG - Intergenic
1051334649 9:16054974-16054996 GTGGATGCAGAGAGGCCAGTTGG + Intronic
1054734876 9:68740883-68740905 CTTCAGGCTCAGAAGCCACTTGG + Intronic
1058696004 9:107559508-107559530 CTTGAAGCACAGTGCCCGGTGGG + Intergenic
1058786831 9:108396324-108396346 ATAAAGGCACAGAGGTCAGTGGG + Intergenic
1058917122 9:109578475-109578497 CTGGAGACAGAGAGGTCAGTAGG + Intergenic
1060207864 9:121693209-121693231 TCTGAGGCCCAGAGGGCAGTGGG - Intronic
1060439796 9:123627810-123627832 CTTGAAGCAAGGAGGCCAGCAGG + Intronic
1060627483 9:125126902-125126924 CTTGAGGCAAAGAAGCAAATAGG - Intronic
1060736882 9:126071646-126071668 CTTGAGGCTGAGGGGCCAGCTGG - Intergenic
1061045767 9:128164020-128164042 CTGGCGGCTCAGAGGCCAGGTGG + Intergenic
1061316737 9:129801098-129801120 CAGGATGCACAGAGGCCTGTGGG - Intergenic
1061636641 9:131914767-131914789 GTGGAGGCAGAGAGGCCAGTTGG + Intronic
1061873326 9:133532034-133532056 CTTGAGGCAGAGGGGCTGGTGGG - Intergenic
1061903661 9:133685601-133685623 CTTGAAGCCCACAGGCCAGGAGG + Intronic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1186427682 X:9476615-9476637 TTTGAGGCACAGAGGTATGTAGG + Intronic
1187126019 X:16455235-16455257 TCTTAGGCACAGAGCCCAGTAGG - Intergenic
1187944363 X:24411993-24412015 CTTGAGCCAAAGTGGCCTGTTGG - Intergenic
1188612182 X:32114300-32114322 GTTGAGGCACAGAGACAAATTGG - Intronic
1188884655 X:35534556-35534578 CATGAGCCACAGTGCCCAGTTGG - Intergenic
1189752219 X:44233913-44233935 CTTGAGGCAAAGTTGCTAGTTGG - Intronic
1190683621 X:52851341-52851363 CTTCAGGGAGAAAGGCCAGTAGG - Intergenic
1190999524 X:55645808-55645830 CTTCAGGGAGAAAGGCCAGTAGG - Intergenic
1192085448 X:68091791-68091813 CTTGAGGCATAGAGGTAATTTGG - Intronic
1192184566 X:68938386-68938408 CATGAGTCATACAGGCCAGTGGG - Intergenic
1194512277 X:94811489-94811511 CTGCAGGCACAGGTGCCAGTGGG - Intergenic
1195164048 X:102199781-102199803 GTTGAAGCACAGAGGTCACTTGG + Intergenic
1195194813 X:102487314-102487336 GTTGAAGCACAGAGGTCACTTGG - Intergenic
1195799665 X:108693613-108693635 CTCGAGGTAGAGAGACCAGTTGG + Intronic
1197765555 X:130057367-130057389 CTGGAGGCCCAGAGGCCAGGGGG - Exonic
1198517900 X:137427394-137427416 CTAGAGGCCCAGAGGCTAGGAGG + Intergenic
1199801094 X:151252188-151252210 GTTGAGGCACTGAGTCCATTGGG - Intergenic
1200900184 Y:8423626-8423648 CTGGAGGCAGAGAGGCCTGGAGG + Intergenic
1200958090 Y:8971509-8971531 CTGGAGGCTTAGAGGCCTGTGGG - Intergenic
1200986205 Y:9305097-9305119 CTGGGGGCTCAGAGGCCTGTGGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1202232417 Y:22670568-22670590 CTGGGGGCTCAGAGGCCTGTGGG - Intergenic
1202310739 Y:23525590-23525612 CTGGGGGCTCAGAGGCCTGTGGG + Intergenic
1202560063 Y:26145004-26145026 CTGGGGGCTCAGAGGCCTGTGGG - Intergenic