ID: 961539750

View in Genome Browser
Species Human (GRCh38)
Location 3:127591254-127591276
Sequence CGCCGCGTGGAGCAGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961539750_961539759 17 Left 961539750 3:127591254-127591276 CCAGCGCCCTGCTCCACGCGGCG 0: 1
1: 0
2: 0
3: 17
4: 182
Right 961539759 3:127591294-127591316 CTCCTCTTAGCAACCCTGCTAGG 0: 1
1: 0
2: 2
3: 26
4: 313
961539750_961539755 -8 Left 961539750 3:127591254-127591276 CCAGCGCCCTGCTCCACGCGGCG 0: 1
1: 0
2: 0
3: 17
4: 182
Right 961539755 3:127591269-127591291 ACGCGGCGCCGCCATGCCTCGGG 0: 1
1: 0
2: 0
3: 2
4: 42
961539750_961539754 -9 Left 961539750 3:127591254-127591276 CCAGCGCCCTGCTCCACGCGGCG 0: 1
1: 0
2: 0
3: 17
4: 182
Right 961539754 3:127591268-127591290 CACGCGGCGCCGCCATGCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961539750 Original CRISPR CGCCGCGTGGAGCAGGGCGC TGG (reversed) Intronic
900126646 1:1071766-1071788 CGCCCCATGGAGCTGGGCGAGGG + Exonic
900366890 1:2315121-2315143 CGCTGCGGGAAGCAGGGCGGCGG + Intergenic
900680692 1:3914732-3914754 GGCCGCCTGGAGCAGGGCCGAGG - Intergenic
901540180 1:9910374-9910396 GGGCGCGTGGGGCCGGGCGCCGG + Intergenic
901660736 1:10796423-10796445 TGCCGCTTGCAGCAGGGAGCGGG - Intronic
901791287 1:11654816-11654838 CGCTGCGCGGGGCGGGGCGCGGG + Intronic
902600890 1:17539694-17539716 CGCCGCGTCGCGCACGGCGGCGG + Intergenic
904454881 1:30641538-30641560 GCCTGCGTGGAGCAGAGCGCGGG - Intergenic
904684737 1:32251797-32251819 CCCCGCCTGGAGCAGGGTGATGG + Intronic
904831107 1:33307325-33307347 CCCCGCGTGGCGCTGGGCCCGGG - Exonic
905449321 1:38046749-38046771 GGCGGCGCGGCGCAGGGCGCGGG - Exonic
905546476 1:38804221-38804243 GGCCGCGAGCAGCGGGGCGCGGG - Intergenic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
907875476 1:58482826-58482848 AGCCGAGTGGAGCAGGGTGGAGG + Intronic
910232278 1:84998342-84998364 CGGCGGCTGCAGCAGGGCGCTGG - Intergenic
911950905 1:104172558-104172580 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
912492715 1:110070734-110070756 CGCCGCGGGGGGCGGGGGGCGGG + Intronic
913067112 1:115266413-115266435 CACAGCGAGGAGCAGGGCTCAGG - Intergenic
915165661 1:153946513-153946535 CCCCGCGTGGCGCAGCGCGGCGG - Exonic
915764466 1:158349120-158349142 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
916588192 1:166166272-166166294 CGCGGCGTGGGGCAGCGCGGGGG + Exonic
917329762 1:173868706-173868728 CGCCGCCTGGAGCCGGTCCCTGG + Intronic
922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG + Intronic
923055881 1:230425889-230425911 GGGCGCGCGGAGGAGGGCGCCGG - Intergenic
1065284770 10:24176855-24176877 CTCCCCGTGGGGCAGGGCTCGGG - Intronic
1070973410 10:80586105-80586127 CTCCCCGTGGGGCAGGGCTCGGG + Intronic
1072404998 10:95142800-95142822 GGCCTCTTGGAGCAGGGAGCTGG + Intergenic
1073352749 10:102831470-102831492 CGCTGTGTGGCCCAGGGCGCAGG + Intronic
1074121523 10:110497498-110497520 CGCCGCGCTGAGCAGGGCCGAGG - Intergenic
1074291416 10:112140384-112140406 CCCCGCCTGGACCAGGGTGCAGG - Intergenic
1080727883 11:34916148-34916170 CGGCGGCTGGAGCTGGGCGCAGG - Intronic
1081315217 11:41623061-41623083 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1083442750 11:62687912-62687934 GGCCGCGTGGACCAGAGTGCGGG + Exonic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1084310307 11:68312798-68312820 CGCCGCGGGTAGGTGGGCGCAGG + Exonic
1085322522 11:75583649-75583671 CGCCGCGAGGGGCAGGGAGTCGG - Intergenic
1085474846 11:76783317-76783339 CGCCGCGCGGAGAAAAGCGCTGG + Intronic
1087175295 11:95090176-95090198 CGCCGCCGGGCGCAGGGCGCGGG - Exonic
1098255435 12:68611088-68611110 GGCCGCGCGGGGCCGGGCGCCGG + Intronic
1101357791 12:103996798-103996820 CGCCGCGTGGCCCAGGGCCAAGG + Exonic
1103760853 12:123249450-123249472 CTCCCCGTGGAGCAGGGCGTGGG - Intronic
1105777616 13:23677956-23677978 CTCCCCGTGGGGCAGGGCTCAGG - Intergenic
1105883507 13:24623586-24623608 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
1106517144 13:30465324-30465346 CGCCGCAGCGAGCCGGGCGCTGG - Intronic
1106735814 13:32586843-32586865 CGCGGCGTGGAGGCGCGCGCCGG - Intronic
1107770866 13:43786684-43786706 CGCTGCGCGGAGTGGGGCGCCGG + Exonic
1109007789 13:56900959-56900981 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
1109124902 13:58505561-58505583 CTCCCCGCGGAGCAGGGCTCAGG - Intergenic
1109858833 13:68171148-68171170 CTCCGCGCGGGGCAGGGCGCGGG + Intergenic
1110775659 13:79405845-79405867 CGGCGCGCGGAGGAGGGGGCGGG - Exonic
1112290724 13:98142846-98142868 CGCCGCGCGGAGCCCGGCCCTGG + Intronic
1113914705 13:113863472-113863494 CGCCGCGCGGAGCTGGGGGGCGG + Intronic
1113914805 13:113863873-113863895 CGGCGCGCGGCGCAGGGCGGCGG + Exonic
1114553953 14:23550980-23551002 CGCCGAGTTGGGCAGGGAGCGGG - Intronic
1118006559 14:61568803-61568825 CGCCGTGTGGGGCGGGGCGGAGG + Intronic
1118806057 14:69237799-69237821 CTCCGCGTTGAGCAGGGCCCTGG - Exonic
1119609999 14:76053617-76053639 CGCCTCGTGGAGCAGGGTGAGGG - Intronic
1127752525 15:62060178-62060200 CGGCGCAGGGAGCAGGGCCCGGG + Intronic
1128067957 15:64775862-64775884 CTCGCCGTGGAGAAGGGCGCGGG - Intergenic
1128598547 15:68975800-68975822 CTCCCCGTGGGGCAGGGCTCGGG - Intronic
1131431713 15:92393787-92393809 CTGCGCGCGGAGCCGGGCGCGGG + Intergenic
1132683686 16:1153658-1153680 CGCCGCGGGAGGCAGGGCGGGGG + Intronic
1133143077 16:3762594-3762616 TGCCGCGTGGAGCAGGTCCTCGG - Intronic
1133304833 16:4802352-4802374 CGCCCGGCGGGGCAGGGCGCGGG + Intronic
1136419550 16:30123226-30123248 CGCCGTGGGGAGGAGGGCGGTGG - Exonic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1138291354 16:55849806-55849828 TGCAGCGCGGAGCAGGGGGCTGG + Intronic
1138619066 16:58197703-58197725 GGCCGCGGGCAGCAGGGCCCGGG - Exonic
1142156143 16:88533612-88533634 AGCCGGCTGCAGCAGGGCGCGGG + Exonic
1142214229 16:88822896-88822918 CTCAGCATGGTGCAGGGCGCTGG + Intronic
1144763841 17:17722477-17722499 CGGCGCGTGGAGCCTGGCGGAGG - Intronic
1145962819 17:28897411-28897433 CACCGCGCGGCGCAGGGCGCTGG - Intronic
1147137539 17:38442878-38442900 TGCCGCTTGGAGCAGGGCAATGG + Intronic
1148077582 17:44947736-44947758 CGCCGGGTGGAGGTTGGCGCGGG - Intergenic
1149753999 17:59172752-59172774 CTCCCCGTGGGGCAGGGCTCGGG + Intronic
1151472286 17:74325947-74325969 CGCCGCGAGCAGAGGGGCGCGGG + Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152745057 17:82034696-82034718 GGCAGGGTGGAGGAGGGCGCGGG + Intergenic
1153868734 18:9297166-9297188 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1159109823 18:64043193-64043215 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
1161509905 19:4664574-4664596 CGGAGCGTGGACCAGGGCCCAGG - Intronic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1163442480 19:17328812-17328834 GGCGGCGGGGCGCAGGGCGCCGG + Exonic
1165093461 19:33398132-33398154 GGCCACGGGGAGCAGGGCGGCGG - Intronic
1165154176 19:33777423-33777445 CGCCCCGGGGAGCAGGGTGTGGG + Intergenic
1167267987 19:48493038-48493060 GGGCGGATGGAGCAGGGCGCGGG - Intronic
1167322891 19:48807283-48807305 CGCAGCATGGAGGAGGGGGCGGG - Intronic
926282993 2:11465705-11465727 CGGCGCGGGGAGGAGGGGGCCGG + Intronic
929548716 2:42875375-42875397 CGCCGGGAGGAGGAGGGAGCTGG - Intergenic
931035712 2:58240984-58241006 CGCGGCGTGGAGCGGGGCTGGGG - Intronic
933157671 2:78993196-78993218 CGAGGCGCGGAGAAGGGCGCGGG - Intergenic
936865385 2:117071712-117071734 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
939612926 2:144332280-144332302 CGGCGCGGGGAGCCGGGGGCGGG - Intronic
942170229 2:173282719-173282741 CTCCGCGCGGGGCAGGGCTCGGG - Intergenic
944632766 2:201643443-201643465 CGTCGCGGGGAGCTGGGCTCGGG - Exonic
944780764 2:203014830-203014852 GGCCGGGAGGAGCAGGGGGCGGG - Intergenic
946394258 2:219435266-219435288 CGCTGCGGGGCGCAGGACGCCGG + Exonic
946982117 2:225229482-225229504 GGCGCCGTGGAGCAGGGGGCGGG + Intergenic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
948449084 2:238057984-238058006 CTCCCCGTGGGGCAGGGCTCGGG - Intronic
948519434 2:238526238-238526260 CCCCGCGTGGACCATGGCCCAGG + Intergenic
948902413 2:240963296-240963318 CGCAGCGTGGGGCCGGGCCCAGG + Intronic
948963337 2:241356669-241356691 TGCCGCGTGGAGGAGGCCGGTGG + Intronic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1169345124 20:4823234-4823256 CGGCGCAAGGTGCAGGGCGCGGG - Intronic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1173831534 20:46092080-46092102 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1174092328 20:48059092-48059114 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1175267134 20:57709741-57709763 CGCCGCGGGGCTCAGTGCGCGGG + Exonic
1179674938 21:42974817-42974839 CGCCGCCCGGGGCAGGGGGCGGG + Intronic
1180109751 21:45642513-45642535 CGCCCCGAGGACCAGGGCGCTGG - Intergenic
1182479408 22:30597093-30597115 CTCCCCGTGGGGCAGGGCTCAGG + Intronic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
950729850 3:14947824-14947846 CGGCGCGGAGGGCAGGGCGCGGG - Intronic
951332933 3:21387383-21387405 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
954265893 3:49470167-49470189 CGCCGCGCGGAGCTGGCCGCTGG + Exonic
958810743 3:98858101-98858123 CTCCCCGTGGGGCAGGGCTCGGG - Intronic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
961700767 3:128743052-128743074 CTCCCCGTGGGGCAGGGCTCTGG - Intronic
961746036 3:129064068-129064090 CGCTGCATGGAGGAGGGTGCAGG + Intergenic
962591049 3:136890128-136890150 CTCCCCGTGGGGCAGGGCTCGGG - Intronic
963533290 3:146497528-146497550 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
964570751 3:158105700-158105722 CGCCGAGAGAAGCAGGGAGCCGG - Exonic
964801551 3:160564783-160564805 CGCCGCGGGAAGGAGGGCGGTGG - Intronic
966915766 3:184583485-184583507 GGCCGCGCGGAGGAGGCCGCGGG + Intronic
968173466 3:196528878-196528900 CTCCGCGGGGAGCTGGGCGGTGG + Intergenic
969714777 4:8863203-8863225 AGGCGGGTGGAGGAGGGCGCCGG + Intronic
969795466 4:9524588-9524610 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
970576846 4:17436696-17436718 CTCCCCGTGGGGCAGGGCTCAGG - Intergenic
972418738 4:38867697-38867719 CTCCTCGTGGGGCGGGGCGCAGG + Intronic
973774257 4:54230675-54230697 CCCCGCGCGGAGAAGGGTGCCGG - Intronic
976102516 4:81580681-81580703 CTCCCCGTGGGGCAGGGCTCGGG + Intronic
978385699 4:108173338-108173360 CGCCGCGCGGGGCCGTGCGCAGG - Intergenic
984966373 4:185143546-185143568 CGGCGCGAGCTGCAGGGCGCGGG + Intronic
985111976 4:186555468-186555490 CGCGGCGTGGAGGAGCGCGCGGG - Exonic
985572437 5:655624-655646 CGCGGGGTGGCGGAGGGCGCGGG + Intronic
992048888 5:72925722-72925744 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
992765096 5:79991128-79991150 CGCCTCGCGGGCCAGGGCGCAGG - Intronic
993770315 5:91917507-91917529 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1002001663 5:176199613-176199635 CGCGGAGGGGAGCGGGGCGCGGG + Intergenic
1002252675 5:177939370-177939392 CGCGGAGGGGAGCGGGGCGCGGG - Intergenic
1002637385 5:180615077-180615099 CACCGCACGGAGCAAGGCGCGGG + Intronic
1003748036 6:9024497-9024519 CTTCCCGTGGAGCAGGGCTCGGG + Intergenic
1004338202 6:14783737-14783759 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
1005059312 6:21761389-21761411 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006179874 6:32148436-32148458 CGCCGAGGGGAGCGGGGAGCGGG + Exonic
1008038838 6:46774926-46774948 GGCGCCGTGGAGCAGGGGGCGGG - Intergenic
1010581969 6:77610365-77610387 GGCCGTGTGGAGCAGGCAGCAGG + Intergenic
1012237772 6:96837863-96837885 AGGCGCGGGGTGCAGGGCGCAGG - Intergenic
1012399972 6:98834946-98834968 GGCGGCATGCAGCAGGGCGCGGG + Exonic
1016461831 6:144286185-144286207 CATCGCGCGGTGCAGGGCGCTGG + Intronic
1017103220 6:150866124-150866146 CGCCGTGGGGAGCGGGGCGCGGG + Intronic
1019343765 7:520063-520085 CCCGGCGCGGAGCCGGGCGCGGG - Intronic
1020018435 7:4846007-4846029 CACCGCGTCCAGCATGGCGCTGG + Intronic
1020084757 7:5304179-5304201 GGCCGGGTGGATCAGGGAGCAGG + Exonic
1020180205 7:5916394-5916416 AGGCGTGTGGGGCAGGGCGCAGG + Intronic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1025209548 7:57013021-57013043 GGCCGGGTGGATCAGGGAGCAGG - Intergenic
1025662400 7:63563829-63563851 GGCCGGGTGGATCAGGGAGCAGG + Intergenic
1026833689 7:73624513-73624535 CGCTGCGCGGAGCAGGGACCAGG - Exonic
1033657057 7:143381513-143381535 CGCAGCGCGGAGCCGGGCTCAGG - Intronic
1033672952 7:143510983-143511005 CGCCGCCCTGAGCAGGGTGCTGG - Intergenic
1033758596 7:144418098-144418120 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
1034100338 7:148445360-148445382 CTCCCCGTGGGGCAGGGCTCAGG - Intergenic
1035255438 7:157622861-157622883 CGCTGCGTGGAGCAGGCAGTCGG - Intronic
1035325439 7:158062802-158062824 CTCCCCATGGGGCAGGGCGCGGG + Intronic
1037769183 8:21789029-21789051 CGGCGCGGGGCGCGGGGCGCGGG + Intronic
1038566211 8:28622347-28622369 CGCCGTGTGCAGCCGGGTGCTGG + Intronic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1040622210 8:49103140-49103162 CTCCCCGTGGGGCAGGGCTCGGG - Intergenic
1041623573 8:60000095-60000117 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
1042137440 8:65645245-65645267 CTCCGGGAGGAGCAGTGCGCTGG + Intronic
1042722518 8:71841695-71841717 CCCCGCGCGGAGGAGCGCGCAGG - Exonic
1043435374 8:80232136-80232158 GGCGCCGTGGAGCAGGGGGCAGG - Intergenic
1047393733 8:124475050-124475072 GGCCGCGCGGGGCAGGGCCCGGG - Exonic
1047400053 8:124538888-124538910 CGCTCAGTGGAGGAGGGCGCGGG - Intronic
1049643876 8:143727574-143727596 GGCCGAGGGGAGCAGGTCGCCGG + Exonic
1049709441 8:144057031-144057053 AGGCGCGTAGAGCAGGGAGCAGG + Exonic
1052014873 9:23452264-23452286 CTCCCCGTGGGGCAGGGCTCAGG + Intergenic
1053323513 9:37120785-37120807 GGCCGCGTGGGGCGGCGCGCAGG - Exonic
1053352494 9:37422846-37422868 CGCGCCGTGGAGGAGGGAGCAGG + Intronic
1055651397 9:78410227-78410249 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1057572972 9:96218274-96218296 CGCCGGTGGGGGCAGGGCGCGGG + Intergenic
1058379548 9:104363030-104363052 CTCCCCGTGGGGCAGGGCTCAGG - Intergenic
1059102373 9:111483439-111483461 CGCCGCGCGGTGCCGGGGGCCGG - Intronic
1060934420 9:127507058-127507080 GGCCCCGTTGAGCAGGGGGCCGG + Exonic
1061407295 9:130399522-130399544 GGCCGTGAGGAGCAGGGCGTTGG - Intronic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1062565200 9:137161219-137161241 CGGGGCGCGGGGCAGGGCGCGGG + Intronic
1062577338 9:137214821-137214843 TGCCGCATGGAGCAGGGCTGGGG - Exonic
1189332878 X:40153926-40153948 CGCCGTGGGGGGCAGGGGGCGGG + Intronic
1197978778 X:132194316-132194338 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1198158617 X:133985751-133985773 CGCGGCGTGGAGCGCGGCGGGGG + Intronic
1198694469 X:139321032-139321054 CTCCCCGTGGGGCAGGGCTCGGG + Intergenic
1199699062 X:150363281-150363303 CGCGGCGCGGAGCCGGGCGGTGG + Intronic
1200544070 Y:4497728-4497750 CTCCCCGTGGGGCAGGGCTCAGG - Intergenic