ID: 961543903

View in Genome Browser
Species Human (GRCh38)
Location 3:127618823-127618845
Sequence TTGTGGAGATGAGCCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961543895_961543903 15 Left 961543895 3:127618785-127618807 CCATAATTAATTTTTAAGACTAT 0: 1
1: 0
2: 6
3: 73
4: 700
Right 961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG 0: 1
1: 0
2: 1
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961543903 Original CRISPR TTGTGGAGATGAGCCCTGTG GGG Intronic
903168991 1:21540590-21540612 TTGGGGAGCAGAGCCCTTTGTGG + Intronic
903665739 1:25006418-25006440 TTGTGCAGGTGAGCCCAGGGAGG + Intergenic
905289757 1:36913185-36913207 GTTTGGAGATGAGCCCAGTTGGG - Intronic
905379421 1:37550331-37550353 TTGTGGATACTAGCCCTTTGGGG - Intronic
908590148 1:65622348-65622370 TTTTAGAGATCAGCACTGTGTGG + Intronic
911373845 1:97026158-97026180 TTGTTGAGTTGAACCCTTTGAGG - Intergenic
911449257 1:98044518-98044540 TTGTGGGCAAGAGCCCAGTGGGG + Intergenic
912383712 1:109261034-109261056 TTGTCCAGGTGAGCACTGTGAGG + Exonic
912511107 1:110190664-110190686 CTGTGGTGACAAGCCCTGTGTGG - Intronic
912577942 1:110692750-110692772 TTGTAGAGACTAACCCTGTGTGG - Intergenic
913581793 1:120233807-120233829 TTGTGGAGATGAGTGCTGCTGGG - Intergenic
913626383 1:120664581-120664603 TTGTGGAGATGAGTGCTGCTGGG + Intergenic
914329010 1:146648673-146648695 TTGGGGAGATGACCCCGCTGGGG - Intergenic
914448823 1:147772960-147772982 TTGTGGAGTTCAGTCCTCTGGGG - Intronic
914563724 1:148845254-148845276 TTGTGGAGATGAGTGCTGCTGGG - Intronic
914609103 1:149284972-149284994 TTGTGGAGATGAGTGCTGCTGGG + Intergenic
916434727 1:164767345-164767367 TTGTGAGCATGAGACCTGTGTGG - Intronic
917303638 1:173605102-173605124 TTGGGGAGTTGAGCGCTGAGAGG + Intergenic
922644628 1:227274206-227274228 TTGTGGAGATGTGGCCACTGGGG - Intronic
922926544 1:229351615-229351637 ATTTGGAGATGGGGCCTGTGAGG - Intergenic
923224897 1:231930225-231930247 TTGTGCAGATGAGAGATGTGAGG + Intronic
1064864391 10:19862871-19862893 GTGTGGAGGTGAGTTCTGTGGGG + Intronic
1065537244 10:26727212-26727234 TGGTGGAAATGAGACCTGAGAGG + Intronic
1067171828 10:43913040-43913062 ATTTGGAGATGAGGCCTTTGGGG + Intergenic
1068257922 10:54538003-54538025 TTCTGGAGATTAGACCTTTGCGG + Intronic
1069291141 10:66781156-66781178 CAGTGCAGAGGAGCCCTGTGTGG + Intronic
1069744108 10:70703963-70703985 TCGTGGGGCTGAGCCCAGTGTGG + Intronic
1069895330 10:71676997-71677019 TTGAGGAAATGAGCCTTGAGTGG - Intronic
1070661897 10:78312734-78312756 TTCTGGGGATGACCCCTCTGTGG + Intergenic
1070946306 10:80394860-80394882 TTGTGGAAATGAACCCAGAGAGG - Intergenic
1071179904 10:82971207-82971229 TTTTGGAGATGAGGCCTGGTGGG - Intronic
1071413757 10:85421981-85422003 CTGTGGAGTTGAGGCGTGTGGGG - Intergenic
1072237209 10:93463688-93463710 TTGTAGAGATGGGCCGGGTGTGG - Intronic
1073500340 10:103931497-103931519 TTCAGGAGCTGAGCCCTGAGTGG + Intergenic
1074268680 10:111930832-111930854 TAGTTGAGAGAAGCCCTGTGGGG - Intergenic
1074364810 10:112849391-112849413 TTGTGGAGACGACCCCTCTAGGG + Intergenic
1074532624 10:114307304-114307326 TTGTGGACCTGAGCCTTGAGGGG - Intronic
1075337323 10:121617784-121617806 TTGTGGGGAATTGCCCTGTGTGG + Intergenic
1076191344 10:128485641-128485663 TGGTGGAGGTGGGCCCTGTGGGG - Intergenic
1076389468 10:130087754-130087776 TTGGGGAGATGTCCCCTGTCTGG - Intergenic
1076780838 10:132723602-132723624 TTGTGGGGATTGGCCGTGTGGGG + Intronic
1076780847 10:132723632-132723654 TTGTGGGGATTGGCCATGTGGGG + Intronic
1077055656 11:591608-591630 TTGTGGCCATGAGCCCTGTCTGG + Intronic
1077961956 11:7084887-7084909 TTGTAGAAATAAGCCCTTTGAGG + Intergenic
1078242050 11:9538717-9538739 TTCTGGAGCTCAGCACTGTGTGG + Intergenic
1078352470 11:10605716-10605738 TTGTGAAGATGGGCCATGGGCGG - Intronic
1078857304 11:15216783-15216805 TTCTGGAGAGAAGCCCAGTGAGG + Intronic
1079345290 11:19646478-19646500 ATGTGGTCATGAGCCATGTGTGG - Intronic
1080143334 11:28948973-28948995 ATGTGGAGATGGGGCCAGTGAGG - Intergenic
1080655776 11:34256960-34256982 GTGTGTAGATGAGCCCTGGTTGG - Intronic
1081240184 11:40695815-40695837 TTATCCAGATGAGCCCAGTGAGG - Intronic
1081675716 11:44967870-44967892 GGGTGGAGATGGGCCCTGGGAGG + Intergenic
1084486676 11:69452211-69452233 TTGTCCAGATGAGGCCAGTGAGG + Intergenic
1084741099 11:71140090-71140112 TTGTGGGGCTGAGTCCTCTGTGG - Intronic
1085935357 11:81135283-81135305 TTGAGGAGATAGGTCCTGTGAGG - Intergenic
1086033618 11:82390052-82390074 TTGTAGATATGAGCACAGTGTGG + Intergenic
1086339971 11:85838718-85838740 TGCTGGAGATGAGCCCTGGTGGG - Intergenic
1089740494 11:120578816-120578838 TTGTGGAGATGAGCCAAGTGAGG - Intronic
1090347845 11:126085133-126085155 TTGGGGAGAACAGCCCTGTCCGG + Intergenic
1092943862 12:13435460-13435482 TTATGGAGCTCAGCCCTGTAAGG + Intergenic
1097106601 12:56629813-56629835 TGGTGGAGATGACTCCTGTGGGG - Intronic
1097413006 12:59279137-59279159 TAGGGGAGATGAGACCTTTGAGG - Intergenic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1101112721 12:101501813-101501835 TTTTGGAGATTAGCCAGGTGGGG - Intergenic
1102947410 12:117001690-117001712 CTGTGGGGATGAGGCCTGTTGGG + Intronic
1104730212 12:131101216-131101238 TTGTGGGGTGGAGACCTGTGTGG + Intronic
1105343353 13:19549076-19549098 TTGTGGAGGGGAGCACAGTGGGG - Intergenic
1107753260 13:43591961-43591983 TTGTGGAGCTGAGTCGTGTGTGG - Intronic
1108534038 13:51354857-51354879 AGGTGGGGAAGAGCCCTGTGTGG + Intronic
1112742776 13:102494045-102494067 TTGTGGACTTGATCACTGTGTGG - Intergenic
1113411346 13:110093105-110093127 TTGTGGAGATGTTGCCTGAGGGG - Intergenic
1114659743 14:24336519-24336541 TTCTGGAGAGGAGCTCTGAGGGG - Intronic
1115137327 14:30126853-30126875 TCCTGGAGATGAGCCCAGTTAGG - Intronic
1117953150 14:61102754-61102776 TTGTGGATAAGAGCCAGGTGAGG - Intergenic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1120536550 14:85703169-85703191 TTGTAGAAATTATCCCTGTGTGG + Intergenic
1121166229 14:91803966-91803988 TTCTGGATATGAGCCCTTTATGG - Intronic
1122375684 14:101255522-101255544 GTGTGGGGATGAGGACTGTGAGG - Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1126385910 15:48093174-48093196 TTTTGGAGAAGAGCTCTGTGGGG - Intergenic
1126797145 15:52268703-52268725 TTCTGAACATGAGCTCTGTGTGG + Intronic
1129418094 15:75400039-75400061 TTGTGAAGATGAACGCTTTGAGG - Exonic
1131418788 15:92285850-92285872 ATGTGGACATGAGCCCCCTGAGG + Intergenic
1131454220 15:92570763-92570785 TTGTGGAAATGACCCCTAAGTGG - Intergenic
1132349845 15:101132920-101132942 GTGTGGAGTGGAGGCCTGTGGGG - Intergenic
1132822195 16:1879831-1879853 CTGTGGCCATGAGCCCTCTGGGG - Intronic
1135665936 16:24335734-24335756 TTGTTGAGATGTGCTCTGTCAGG - Intronic
1136184002 16:28574408-28574430 TTCTGGTGATGTGCCCTGGGAGG + Intronic
1136924743 16:34361760-34361782 CTGTGGAGTTGAACCCTGGGAGG - Intergenic
1136979830 16:35050046-35050068 CTGTGGAGTTGAACCCTGGGAGG + Intergenic
1138247268 16:55477350-55477372 ACGTGGACATGAGCCCAGTGGGG + Intronic
1138556120 16:57772154-57772176 TTGTGCAGATGGGCCCTGCCAGG - Intronic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1139642493 16:68302681-68302703 TTGTGGAGCTGGGCTCTGAGTGG - Intronic
1140004556 16:71062270-71062292 TTGGGGAGATGACCCCGCTGGGG + Exonic
1140467852 16:75196590-75196612 TTGTGTGGACAAGCCCTGTGAGG - Intergenic
1140634855 16:76900139-76900161 TTGTGGAGAGGTAGCCTGTGTGG + Intergenic
1141856507 16:86684856-86684878 TTGTGGTGAGGAGGCCTCTGAGG - Intergenic
1144500446 17:15782326-15782348 TTCTGGATATGAGCCCTTTATGG + Intergenic
1147462284 17:40580934-40580956 TTGGGGTGATGTGGCCTGTGGGG + Intergenic
1147740747 17:42669912-42669934 TTCTGGAGCTGAGCACGGTGAGG - Exonic
1148876151 17:50688468-50688490 ATGAGGAGCTGAGCCTTGTGGGG + Intronic
1150687170 17:67330118-67330140 TTGTGGAAATAGGCCCGGTGCGG - Intergenic
1151347591 17:73511631-73511653 TTGGGGAGAGGAACCTTGTGAGG - Intronic
1151943618 17:77307391-77307413 TGCTGGAGATGATCCTTGTGGGG + Intronic
1152210870 17:79002448-79002470 GTGTGTAGATGCGGCCTGTGTGG + Intronic
1152547535 17:81009328-81009350 CTGTGGAGGTGGCCCCTGTGGGG + Intronic
1154332272 18:13439884-13439906 TTGTGGAGATGAGGGCACTGAGG - Intronic
1154494815 18:14947869-14947891 TTCTGGAGATGGGCCCTTTGTGG + Intergenic
1155415859 18:25598557-25598579 TTGTGAAAATGAGCCATCTGCGG - Intergenic
1156668539 18:39438542-39438564 TTGAGAACATGAGCCCTCTGAGG - Intergenic
1159475601 18:68916896-68916918 GTCTGGACAGGAGCCCTGTGTGG + Intronic
1160096180 18:75875731-75875753 CAGTGGAGAGGAGCCCCGTGTGG + Intergenic
1160534402 18:79584557-79584579 CTGTGTAGATGAGACCTTTGGGG - Intergenic
1160562961 18:79771018-79771040 GTGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160562973 18:79771052-79771074 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160563137 18:79771511-79771533 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160828060 19:1089869-1089891 GTGGGCAGGTGAGCCCTGTGGGG - Exonic
1161734729 19:5984611-5984633 TGGTGGAGATGAGCTCAGGGAGG + Intergenic
1162078389 19:8204376-8204398 TTTTAGAGATGAGCCCAGAGTGG - Intronic
1167096555 19:47377710-47377732 GTGTGGAGATGAGGCCAGAGAGG + Intronic
928193150 2:29192815-29192837 ATGTGGACATGAGCCATTTGAGG - Exonic
929387495 2:41427031-41427053 TTCTGTACATGAGCCCTATGTGG - Intergenic
929592790 2:43157993-43158015 TCGTGGCGATGAGCCATCTGGGG - Intergenic
929921368 2:46174152-46174174 TTGTGGGGAAGGGGCCTGTGAGG + Intronic
930108390 2:47657743-47657765 TACTGGAGCTGAGCCCAGTGGGG + Intergenic
931721510 2:65070539-65070561 TTGTGGGGCTGCACCCTGTGAGG + Intronic
935414352 2:102799855-102799877 TTGTGGAGAGGGGACCTTTGTGG + Intronic
935698129 2:105787363-105787385 ATTTGGAGATGAGCCCTCTGAGG + Intronic
937835263 2:126465071-126465093 TTGGGGATATTATCCCTGTGAGG - Intergenic
938030336 2:127986820-127986842 CCGTGGCGATGAGCCCTGGGCGG + Exonic
939229250 2:139405770-139405792 TTTTGGAGATGAGGCCTGGTGGG - Intergenic
944908930 2:204290362-204290384 GTGTGGAAAGGAGGCCTGTGTGG + Intergenic
945042844 2:205756469-205756491 TTGTAGCCATGAGCCATGTGTGG + Intronic
945212935 2:207402356-207402378 TTGTGGAGATGGGGCCTGATGGG + Intergenic
946453437 2:219800654-219800676 TGGTGGAGATGAGGCCGGTAGGG + Intergenic
946635432 2:221719829-221719851 TTGTGGAGAAGAGGCCTGCATGG - Intergenic
946924379 2:224612168-224612190 TTGTGGAAATGTGCCCTGGGGGG + Intergenic
947011515 2:225571487-225571509 ATGTGGTGCTGGGCCCTGTGGGG - Intronic
947550410 2:231041536-231041558 GTGTGGGGATGAGCAATGTGAGG + Intronic
948604039 2:239123505-239123527 TTGAGGAGATGGGCCCCTTGGGG - Intronic
1169002476 20:2177982-2178004 TTGTGGGCATGTGACCTGTGTGG - Intergenic
1169111595 20:3037524-3037546 AAGTACAGATGAGCCCTGTGGGG - Intronic
1169411268 20:5372438-5372460 TTGTGGAGTTGAGCCCTCAAGGG + Intergenic
1172125182 20:32621323-32621345 CTGTGTAGATGAGGACTGTGAGG + Intergenic
1172853605 20:37984211-37984233 CTGTGGATCTGATCCCTGTGGGG - Intronic
1173165618 20:40685146-40685168 TTCTGCAGATGGGCACTGTGTGG - Intergenic
1178636272 21:34306997-34307019 TTGTGGAGATGTGGCCACTGGGG - Intergenic
1180031180 21:45209454-45209476 TTTTGGAGAAAAGTCCTGTGTGG + Intronic
1180145242 21:45915086-45915108 CTGTGGAGACGAGGCCAGTGTGG - Intronic
1181042344 22:20198076-20198098 TTGGGGAGATGTCCCCTCTGTGG - Intergenic
1181466440 22:23113055-23113077 GCCTGGAGGTGAGCCCTGTGAGG - Intronic
1181573816 22:23781684-23781706 TTCTAGAGATGAGGCCTCTGGGG + Intronic
1183385925 22:37514576-37514598 TTGGGGAGGTGAGCCCTGATGGG - Intronic
1184136001 22:42550203-42550225 TTGAGGACATGACCCCTATGAGG - Intergenic
1184148051 22:42622968-42622990 CTGTGGAGTATAGCCCTGTGTGG - Intronic
1184861483 22:47175408-47175430 TTGCCGAGATCAGCCCTGGGAGG + Exonic
1185092710 22:48784986-48785008 ATTTGGAGATGGGGCCTGTGAGG + Intronic
1185098527 22:48825154-48825176 ATGATGAGATGTGCCCTGTGTGG + Intronic
949104564 3:188458-188480 GTTTGGAGATGAACCCTTTGGGG - Intergenic
951018955 3:17761753-17761775 ATTTGGAGATCAGCACTGTGAGG + Intronic
953406239 3:42661206-42661228 TTGTTGAAATGAGCCCAGAGTGG + Intronic
954420628 3:50417309-50417331 TGGTTGGGATGTGCCCTGTGTGG - Intronic
955343664 3:58144985-58145007 TTGGAGAGATTAGCCCTTTGTGG + Intronic
959229401 3:103629397-103629419 TTGTGCTCAGGAGCCCTGTGTGG + Intergenic
959714457 3:109417307-109417329 ATTTGGAGATGAGGCCTCTGAGG - Intergenic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
961811363 3:129523622-129523644 TGGTGGGGCTGAGCCATGTGGGG + Intergenic
962042450 3:131721262-131721284 TTGGAAAGATGAGCCTTGTGAGG + Intronic
963055087 3:141179670-141179692 TGGTGGAGGTGAGCCTGGTGTGG - Intergenic
963060162 3:141219378-141219400 TTGTGCAGGTCAGCCCTATGTGG - Intergenic
963626560 3:147680702-147680724 TAGCGGAGATTAGCCCTCTGTGG - Intergenic
964310408 3:155386066-155386088 TTCTGGAAATCAGCCCTGTGTGG + Intronic
964501344 3:157351482-157351504 TTGAGGAGATGGGCCAAGTGCGG - Intronic
967102368 3:186226331-186226353 TTGTGGAGATGGGGCCAGAGGGG + Intronic
968628728 4:1639334-1639356 TTGTGGAGATCAGCTCCGGGTGG - Intronic
969314372 4:6372650-6372672 TGGTGGAGGTGAGCCCTCGGAGG - Exonic
972006938 4:34121276-34121298 TTGTGGAGATCAGTCTTTTGTGG + Intergenic
973613921 4:52660160-52660182 TTGTTGAGATGGGCGCTGTATGG + Intergenic
974119242 4:57618952-57618974 CGGTGGAGGTGAGGCCTGTGAGG + Intergenic
974348603 4:60715234-60715256 TGTTGGAGATGGGCCTTGTGGGG - Intergenic
975851506 4:78577684-78577706 GTGTGTAGATGAGGTCTGTGAGG + Intronic
977371421 4:96141962-96141984 TTATGGAGATGAGTTCTGTGAGG - Intergenic
981404130 4:144347393-144347415 CTGTGGGGCTGTGCCCTGTGTGG - Intergenic
982063504 4:151628423-151628445 AAGTGTAGATGAGCCCTGAGTGG - Intronic
985362094 4:189186323-189186345 GCGTGGATATGAGCTCTGTGTGG - Intergenic
986091088 5:4507619-4507641 TTTTGGAGGTGACCCTTGTGAGG + Intergenic
986576262 5:9215919-9215941 TTGTCTAGATGAGCACTGTGGGG + Intronic
986878245 5:12137433-12137455 TTCTGGAGATTAGACCTTTGGGG - Intergenic
987278825 5:16391255-16391277 TTGTGGAGCTTAGGCCTTTGTGG - Intergenic
989240004 5:39193086-39193108 TTGTGGACATGATCCCAGTGGGG - Intronic
997019711 5:129984911-129984933 TTGTGGATATTAGACCTTTGAGG + Intronic
997587794 5:135054000-135054022 CTGTGGTGGTGACCCCTGTGAGG + Intronic
997642787 5:135460428-135460450 TGGTGGGGGTGAGCCATGTGAGG - Intergenic
998159533 5:139805646-139805668 TGTTGGAGTTGAGCCCTGAGTGG + Intronic
998881228 5:146647338-146647360 TTGTGGAAATGAGACCTGCCTGG + Intronic
1000874599 5:166620393-166620415 TTATGGAGCTGAGCTCTATGAGG - Intergenic
1001175329 5:169463338-169463360 TTGTGGGGAAGAGCCCAGAGTGG - Intergenic
1003718448 6:8673688-8673710 ATTTGGAGATGGGGCCTGTGAGG + Intergenic
1003991719 6:11493083-11493105 ATGTGGAGATGGTCCCTGTTGGG + Intergenic
1005079414 6:21941747-21941769 CTTTGGAAATGAGCCCTTTGAGG + Intergenic
1005812877 6:29530055-29530077 TGGGGGAGCTGAGCACTGTGGGG - Intergenic
1010075767 6:71795867-71795889 TTCTGTAGATGAGCTCTCTGTGG + Intergenic
1012640942 6:101612787-101612809 CTGGGCAGATGAGCCCTGTTTGG + Intronic
1015885091 6:137909726-137909748 TGGCAGAGAGGAGCCCTGTGAGG + Intergenic
1018101055 6:160440850-160440872 TTGTGGAGATGTGGTCTGTCCGG - Intronic
1018214093 6:161509959-161509981 TTGTGCAGCTCAACCCTGTGTGG + Intronic
1019148546 6:169988977-169988999 TGGGCGGGATGAGCCCTGTGGGG + Intergenic
1019574324 7:1729109-1729131 TTGAGCAGAGGGGCCCTGTGTGG - Intronic
1021331181 7:19340453-19340475 TTGAGGGGATGAGCCCTCTCAGG + Intergenic
1022292711 7:29019781-29019803 TTGTGGAGATGAGGGTTATGAGG - Intronic
1024035632 7:45505676-45505698 GTGTGGAGATGATGACTGTGGGG + Intergenic
1024654392 7:51437120-51437142 TTGTGGATATGAGCCCCTTATGG + Intergenic
1025841404 7:65153196-65153218 CTGTAGAAATGAGGCCTGTGTGG + Intergenic
1025881643 7:65542773-65542795 CTGTAGAAATGAGGCCTGTGTGG - Intergenic
1025891798 7:65659859-65659881 CTGTAGAAATGAGGCCTGTGTGG + Intergenic
1026146936 7:67754649-67754671 TTGTGGAGAAGAAACCTGAGAGG + Intergenic
1026386726 7:69857272-69857294 TCCTGGAAATGAGCCCTGAGAGG + Intronic
1026416591 7:70187890-70187912 TTATGAAGATCAGCCCTGTTGGG + Intronic
1027232698 7:76281843-76281865 TAGTGGAGGGGAGCCCTGTGCGG - Intronic
1028214570 7:88115625-88115647 GTCTGGAGATAAGGCCTGTGAGG - Intronic
1029242929 7:99177287-99177309 TTGTGGAGACGGGCCGGGTGTGG + Intronic
1029498072 7:100908726-100908748 TGTTGGAGATGAGCCCTGGTTGG + Intergenic
1029644798 7:101847342-101847364 TTTTGGAGATGACCCATGTTTGG + Intronic
1030304472 7:108004180-108004202 TCGTCGAGATGAGCGTTGTGGGG - Intergenic
1030804232 7:113894513-113894535 TTGTGGAGATAAGACTTCTGAGG - Intronic
1032400406 7:131620409-131620431 TTGTGGACCTGCTCCCTGTGGGG + Intergenic
1032510345 7:132467188-132467210 CTGTGGAGATGACCCCAGAGAGG - Intronic
1035116896 7:156532438-156532460 GTTTGGAGATGGGGCCTGTGAGG - Intergenic
1035396586 7:158538969-158538991 TTGGAGAGCTGAGCCCTGGGGGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037566778 8:20124745-20124767 TTGTGAATATGATCCCTATGTGG - Intergenic
1038349775 8:26765370-26765392 GAGTGGAGATGATCACTGTGGGG - Intronic
1038396827 8:27252382-27252404 TTCTGGATATTAGCCCTTTGTGG - Intronic
1039208767 8:35187289-35187311 TTGTAGAGATAGGGCCTGTGAGG - Intergenic
1041570800 8:59335058-59335080 TTGTGGTAATGAACACTGTGGGG - Intergenic
1042500109 8:69499553-69499575 TTTTGGAGCTGAGAACTGTGAGG + Intronic
1048155321 8:131942675-131942697 TAGTGGAGATAAGTACTGTGAGG + Intronic
1048690481 8:136956695-136956717 TTGTGCAGATGAAACCTGTCAGG - Intergenic
1049925924 9:407013-407035 CTGTGAAGAGGAGCCCGGTGAGG - Exonic
1050416367 9:5421418-5421440 TAGTGGTGATGAGTTCTGTGAGG - Intronic
1050684136 9:8147835-8147857 TTCTGGAGATGGGCCCTGACTGG + Intergenic
1050719876 9:8575897-8575919 TTATGGAGTTCAGCCCTCTGAGG - Intronic
1051881794 9:21848099-21848121 CTGAGGAGATAAACCCTGTGCGG + Intronic
1053463968 9:38291436-38291458 TTGTGGATATCAGGCCTTTGGGG + Intergenic
1053575274 9:39353601-39353623 CTGTGGAGATGAGCTCTTTAGGG - Intergenic
1053839778 9:42181535-42181557 CTGTGGAGATGAGCTCTTTAGGG - Intergenic
1054096836 9:60912284-60912306 CTGTGGAGATGAGCTCTTTAGGG - Intergenic
1054118240 9:61187910-61187932 CTGTGGAGATGAGCTCTTTAGGG - Intergenic
1054589515 9:66994654-66994676 CTGTGGAGATGAGCTCTTTAGGG + Intergenic
1056840041 9:89991380-89991402 TTGTGGAGTTCAGGCCTGTTTGG + Intergenic
1057187404 9:93064654-93064676 GTGTTGTGCTGAGCCCTGTGGGG - Intronic
1057401511 9:94727102-94727124 GACTGGAGATGAGCCCTGTGGGG - Intronic
1060438335 9:123615589-123615611 TAGTGAAGCTGAGGCCTGTGGGG - Intronic
1060866927 9:127007903-127007925 CTGTGGAGAAGAGACCTGCGAGG + Intronic
1061680558 9:132240812-132240834 GTGTGGAGATGCTCCCTGCGAGG + Intronic
1189196727 X:39159863-39159885 ATGTGGAGATGAGCTTTGAGGGG - Intergenic
1189227669 X:39426981-39427003 CTGTGGGGAAGGGCCCTGTGGGG + Intergenic
1189916952 X:45864752-45864774 TTTTGGAGGTGAGGCCTGTTGGG + Intergenic
1190305014 X:49076903-49076925 TTGTGGATATGATCCCTGAGAGG + Intronic
1192165313 X:68824185-68824207 TTCTGAAGATGAGGCCTCTGAGG + Intergenic
1192203785 X:69083006-69083028 TTGTTGGGCTGAGCCCTGGGGGG - Intergenic
1195240797 X:102949903-102949925 TTGTGGAGTGGGGACCTGTGGGG - Intergenic
1198113896 X:133526468-133526490 AGGTGGAGCTGAGCACTGTGGGG + Intergenic
1199233763 X:145468101-145468123 CTGAGGGGATGAGCCCTCTGTGG + Intergenic
1199694881 X:150336887-150336909 TTTTGTAAATGAGACCTGTGTGG + Intergenic
1199698020 X:150357629-150357651 TTTTGGAAATGAGACCTGTGAGG + Intergenic