ID: 961545184

View in Genome Browser
Species Human (GRCh38)
Location 3:127628698-127628720
Sequence AGTCTGGCTCAGGATCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961545184_961545191 24 Left 961545184 3:127628698-127628720 CCAATCTGATCCTGAGCCAGACT 0: 1
1: 0
2: 1
3: 11
4: 132
Right 961545191 3:127628745-127628767 TGCTCTCAGGTTCTCCTTCAGGG 0: 1
1: 0
2: 0
3: 22
4: 260
961545184_961545190 23 Left 961545184 3:127628698-127628720 CCAATCTGATCCTGAGCCAGACT 0: 1
1: 0
2: 1
3: 11
4: 132
Right 961545190 3:127628744-127628766 TTGCTCTCAGGTTCTCCTTCAGG 0: 1
1: 0
2: 1
3: 24
4: 282
961545184_961545188 11 Left 961545184 3:127628698-127628720 CCAATCTGATCCTGAGCCAGACT 0: 1
1: 0
2: 1
3: 11
4: 132
Right 961545188 3:127628732-127628754 AAGTCCAGTTCTTTGCTCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961545184 Original CRISPR AGTCTGGCTCAGGATCAGAT TGG (reversed) Intergenic
900623051 1:3596189-3596211 AGGCTGGCTCCTGCTCAGATGGG + Intronic
904488593 1:30844237-30844259 AGGCTGGCTCAGGACCAGGTTGG - Intergenic
904807570 1:33142570-33142592 AGACTTGCTCAGGGTCACATGGG + Intergenic
905278652 1:36835138-36835160 GGTCTGGCACAGTATCAGTTGGG + Intronic
907535834 1:55155768-55155790 CGTCTGGCTTAGGTTCAGAGTGG + Intronic
911908823 1:103605287-103605309 CGTCTTGCTCAAGATCAGTTTGG - Intergenic
911914094 1:103674174-103674196 CGTCTTGCTCAAGATCAGTTTGG + Intronic
912956059 1:114154696-114154718 AGTGAGGCCCAGGAACAGATCGG + Intergenic
913097577 1:115534196-115534218 AGTCTCGCTCAGGCTGACATGGG - Intergenic
919954406 1:202398639-202398661 TGTCTGGCACAGGATCATTTGGG + Intronic
921405851 1:214778698-214778720 AGTGTGGCTAAGGAGCAGAAAGG - Intergenic
1066243899 10:33563407-33563429 AGGCTGGGTCAGGGACAGATGGG + Intergenic
1072167681 10:92829716-92829738 ATTCTGTCACAGGATGAGATAGG + Intergenic
1073120052 10:101116225-101116247 GCACAGGCTCAGGATCAGATTGG + Intronic
1075347464 10:121694176-121694198 ATTCTACCTCAGGATCAGAATGG + Intergenic
1075360454 10:121827570-121827592 AGTGTAGCTCAGTATCAGTTCGG - Intronic
1076045474 10:127291101-127291123 ACTCTGGCTTAGGTTGAGATTGG + Intronic
1078073606 11:8136544-8136566 AGGCTGGCTGAGGATCTGAAAGG - Intronic
1078101054 11:8330559-8330581 AGTCTGGCTCACGGCCAGATGGG - Intergenic
1080103122 11:28482703-28482725 AGTGTGGCTCAGCATCACCTGGG + Intergenic
1088499173 11:110465407-110465429 AGTCTGGCCCATCATCAGAAGGG + Intergenic
1089582165 11:119488405-119488427 AGTTGGGGCCAGGATCAGATGGG - Intergenic
1092407716 12:8232587-8232609 AGGCTGGGCCGGGATCAGATGGG - Intergenic
1094413951 12:30198186-30198208 AGTCTTGCTCAGGATTAGGACGG + Intergenic
1096919111 12:55065277-55065299 AGTCTGGTTAAGGATGAGATTGG + Intergenic
1097578586 12:61425957-61425979 AGTCTAGCTCAGGTTAAAATTGG + Intergenic
1102738176 12:115181779-115181801 AGTCTGGCTCAGGTTTGGATGGG + Intergenic
1102947714 12:117004622-117004644 TGTCTGCCTCAGGTTCAGTTCGG - Intronic
1103226571 12:119292870-119292892 AGCCTGGCTGAGGAAGAGATTGG + Intergenic
1103246573 12:119463160-119463182 AGTCTGTCTCAGGATCCAACAGG + Intronic
1104158234 12:126153703-126153725 AGTCTGCCTCAGGGACACATTGG + Intergenic
1105419164 13:20237612-20237634 AGTTTTTCTCATGATCAGATGGG + Intergenic
1108857842 13:54818297-54818319 AGTGTGTCTCAGGATAAAATTGG + Intergenic
1109369308 13:61400468-61400490 AGTCTTTCTCATGCTCAGATTGG - Intergenic
1111802947 13:93002624-93002646 AGTCTGGCTCAAGGTAGGATAGG - Intergenic
1112532110 13:100214995-100215017 AGACTGGCACAGTATCAGTTTGG - Intronic
1113453853 13:110433242-110433264 AGCCTGGAGCAGGATGAGATGGG + Intronic
1113872272 13:113566516-113566538 AAACTGGGTCAGGATCAGACAGG - Intergenic
1114550787 14:23531738-23531760 AGGCTGGCTCAGGCCCAGAAGGG + Intronic
1117448861 14:55831409-55831431 ATTCTGTCACAGGATGAGATAGG + Intergenic
1117574879 14:57087863-57087885 AGCAGGGCTCAGGATGAGATGGG + Intergenic
1119186580 14:72647065-72647087 AGGCTGACTCAGGATGAGAGTGG - Intronic
1120216369 14:81684612-81684634 AGTCTAGTACAGGATCTGATGGG + Intergenic
1120671332 14:87365805-87365827 AGTCTGGCTCATGCTAAGAGGGG + Intergenic
1122141100 14:99663573-99663595 ATTCTGTCACAGGATGAGATAGG - Intronic
1124991582 15:34679577-34679599 TATCTGGCTCAGGATCAGCAAGG + Intergenic
1125728680 15:41881108-41881130 AGTCAGGGTCAGGCTCAGCTGGG + Exonic
1126286526 15:47019049-47019071 AGTCTGTCTCAGCAACAGACTGG + Intergenic
1128544145 15:68556056-68556078 TGCCTGGCTCAGGATAAGGTGGG + Intergenic
1128556461 15:68635197-68635219 AGTCTGGCAGGGGATCAAATGGG - Intronic
1131296144 15:91150910-91150932 AGTCTAGCCCAGGAGCAGAGGGG - Intronic
1132300536 15:100772833-100772855 AGTCTGGCCCTGGAACAGACTGG - Intergenic
1132571918 16:647926-647948 GGCCTGGGTCAGGATCAGAGGGG - Intronic
1134389584 16:13807121-13807143 AGTGTGGCTCAGAAGCAAATGGG + Intergenic
1136381580 16:29898500-29898522 AGTCTGGCTGGGGGTCAGAGTGG + Intronic
1136385193 16:29920901-29920923 AGACTGGCACAGAATCAGAAGGG + Intronic
1136399644 16:30010544-30010566 AGGCAGGCTCAGGAGCAGAGGGG - Intronic
1137290932 16:47051431-47051453 AGCCTGGCCCAGGACCAGACAGG - Intergenic
1137365421 16:47855639-47855661 AGGCTGGCTCAGGAGCAGCCAGG + Intergenic
1139592687 16:67942299-67942321 AGGCAGGCCCAGGATCAGCTTGG + Intronic
1139902775 16:70341312-70341334 AGTCTGGCTCAAGACCAGCCTGG + Intronic
1142694719 17:1627567-1627589 GGGCTGGGTGAGGATCAGATGGG + Intronic
1146976627 17:37118893-37118915 ATTTTGGCTCAGGCCCAGATTGG - Intronic
1147433671 17:40392646-40392668 GGTCTGATTCAGAATCAGATAGG - Exonic
1147543812 17:41382797-41382819 AGTAAGGCTCAGGATCATTTCGG - Intronic
1149042606 17:52207903-52207925 ACTCTGTCTAAGGATCAGTTTGG + Intergenic
1151674749 17:75591674-75591696 AGCCTGGAGCAGGATCAGACGGG + Intergenic
1153491600 18:5655226-5655248 AGTCTGGCTCAGGATCTGGGTGG - Intergenic
1157102411 18:44742874-44742896 ACTCTGGCCAAGGAACAGATGGG + Intronic
1158223704 18:55178344-55178366 AGACTGTCTCAAAATCAGATAGG + Intergenic
1159365196 18:67456308-67456330 AGTCTGTCTCAGAATGAGACAGG - Intergenic
1160111964 18:76041573-76041595 AATCTGGCTGAATATCAGATAGG + Intergenic
1164437402 19:28242776-28242798 AGTCTGTCCCCGGATAAGATAGG - Intergenic
1166333909 19:42094052-42094074 CTTGTGGCTCAGGATCAGCTAGG - Intronic
1167688511 19:50970896-50970918 AGTCTGGCTCAGCACCTGCTTGG + Intergenic
1167791733 19:51687812-51687834 AGTCTGGCCCAGGAACGGATGGG - Intergenic
932819477 2:74887298-74887320 AGGCTGGGTCAAGATAAGATGGG + Intronic
934725029 2:96610976-96610998 AGTCAGCCTCAGCATCAGCTTGG + Intronic
938592703 2:132754904-132754926 ATTCTAGTTCAGAATCAGATTGG + Intronic
940378173 2:152981448-152981470 AGAGTGGGTCAGGATCAGATAGG - Intergenic
941871376 2:170389342-170389364 AGTCTGGCACAGTGTAAGATGGG + Intronic
942480608 2:176384265-176384287 TGTCTGGCTCAGCATGAGACTGG + Intergenic
943373148 2:187041526-187041548 GGACTGGGTCAGGATCAAATTGG - Intergenic
946666251 2:222052902-222052924 AGTCAGGCTCACAAGCAGATAGG - Intergenic
946766780 2:223047862-223047884 AGTGTGTGTCAGGATCAAATAGG + Intergenic
947151712 2:227122813-227122835 AGTGTGGATCAGGACCAGGTGGG - Intronic
948862958 2:240761782-240761804 AGTCAGGCTGAAGATCAGAGTGG + Intronic
1169347254 20:4838570-4838592 ATTCTCACTCAGGATCAGAGAGG + Intergenic
1172879994 20:38193713-38193735 GGTCTGGGTCAGTATCAGAGAGG + Intergenic
1173995970 20:47338923-47338945 AGGCAGGCTCGGGACCAGATAGG - Intronic
1175428454 20:58886466-58886488 CGTCTGGCTCAGGAAGAGAAGGG - Intronic
1176289929 21:5038341-5038363 AGGCTGGCTCAGGATGAGGATGG - Intronic
1177390331 21:20460327-20460349 AGTCTGCCTAGAGATCAGATGGG + Intergenic
1179867323 21:44225298-44225320 AGGCTGGCTCAGGATGAGGATGG + Intronic
1180701150 22:17782065-17782087 AGTCTGGCTGTGGCTCAGAATGG + Intergenic
1181027154 22:20132781-20132803 AGGCTGGCTTAGGACCAGAGAGG + Intronic
1182228036 22:28815254-28815276 AGAGTGGCTCAGGCTAAGATGGG - Intergenic
950545722 3:13636931-13636953 GGTCTGGCTCAGGATCTCAGGGG + Intronic
952743965 3:36760941-36760963 TATCTCGCTCAGGATCACATGGG + Intergenic
954351440 3:50047517-50047539 AGTCTGGCACAGGAACAGGTGGG - Intronic
954464054 3:50644329-50644351 AGTCTGGCTGAAGATCACCTTGG + Intronic
954804733 3:53210908-53210930 AGCCTGGCTCATGAACAGAATGG - Intergenic
961545184 3:127628698-127628720 AGTCTGGCTCAGGATCAGATTGG - Intergenic
961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG + Intronic
963769527 3:149375800-149375822 TGTCTTGCTCAGGCTCATATGGG + Intronic
969350679 4:6596374-6596396 AGTCTGGTTCAGGACCAGTGGGG + Intronic
981247934 4:142562384-142562406 AGTCTGGCTCATGGAGAGATGGG - Intronic
981769172 4:148287285-148287307 TGTCTGGCAGAGCATCAGATAGG - Intronic
992529773 5:77643113-77643135 AGTCTGGGACAGGGTCAGGTGGG - Intergenic
992911493 5:81399956-81399978 AGTCTGGCTCTTGTTCAGCTGGG + Intergenic
996837220 5:127806701-127806723 AATGTGGCTCAGGATCAGAGTGG - Intergenic
1002915848 6:1527168-1527190 AGTCTGGCTCAGAGTCAGCCCGG - Intergenic
1006152294 6:31995983-31996005 AGTTTGGCCCAGGAGCAGGTAGG + Exonic
1006158597 6:32028721-32028743 AGTTTGGCCCAGGAGCAGGTAGG + Exonic
1006566171 6:34959521-34959543 ACTGTGGCTCAGGATCAGATAGG + Intronic
1007803311 6:44416706-44416728 AGTTTGGCCCAGTATGAGATTGG - Intronic
1008676873 6:53828367-53828389 TGCCTGGCTCAGAACCAGATGGG - Intronic
1010911701 6:81566328-81566350 ACTCTGGCTCAGGATCAGGCAGG + Intronic
1011816820 6:91201272-91201294 AGTCTCTCTCAGGAGCAGAGAGG - Intergenic
1013495130 6:110690312-110690334 AGTCTGGCTATTTATCAGATGGG - Intronic
1014418380 6:121211840-121211862 AGTTTGGCTCAGGTCCAGAGAGG - Intronic
1015442799 6:133268633-133268655 ACTCTGGCTCAGGTTCACCTTGG - Intronic
1023764394 7:43497292-43497314 AGTGTGGCCCAGGAGTAGATTGG + Intronic
1024670546 7:51589902-51589924 ACACAGGCTTAGGATCAGATAGG - Intergenic
1029335187 7:99892872-99892894 GGCCTGGCTGAGGATCAGTTGGG - Intronic
1031552023 7:123126335-123126357 AGACTGATTCAGGAACAGATGGG + Intronic
1032898406 7:136278612-136278634 AGTCAAACTCAGGATCAGAGAGG + Intergenic
1033475200 7:141685657-141685679 AGTGTGGCTCAAGATCAGAGAGG + Intronic
1036828514 8:12000063-12000085 TGTATGGCTCAGGGTCAGACAGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048387850 8:133929822-133929844 AGTCAGCCACAGGATCAGAGCGG - Intergenic
1049778685 8:144417772-144417794 AGCTTGGGTCAGGATAAGATTGG + Intergenic
1051812891 9:21070346-21070368 AGTCTGGCAAAGGAGCAAATGGG + Intergenic
1058189064 9:101891133-101891155 AGTATAGCTCAGGATCACAGGGG + Intergenic
1060182707 9:121545467-121545489 AGTCTGGCTCAGCCACAGACAGG - Intergenic
1061752241 9:132787402-132787424 ATGAAGGCTCAGGATCAGATTGG + Intronic
1062042958 9:134412482-134412504 ACTCTGGCTCTGGGGCAGATGGG + Intronic
1185519793 X:729782-729804 AGACTGGGTCAGGTACAGATGGG + Intergenic
1190816644 X:53935513-53935535 AGTCTGTCTCAGGAGTAGGTGGG - Intergenic
1196946990 X:120836994-120837016 ATTTTGGCTCAGGGTCAGAGAGG + Intergenic
1198214914 X:134546547-134546569 AGGCCGGCTCAGGAGCAGGTAGG - Intergenic
1200969941 Y:9141089-9141111 AGTTTGGCCCAGGATCAGTCAGG - Intergenic
1202141061 Y:21723157-21723179 AGTTTGGCCCAGGATCAGTCAGG + Intergenic
1202145804 Y:21780641-21780663 AGTTTGGCCCAGGATCAGTCAGG - Intergenic
1202580220 Y:26372684-26372706 TGTCTGGCACAGGATCATTTGGG - Intergenic