ID: 961545502

View in Genome Browser
Species Human (GRCh38)
Location 3:127629987-127630009
Sequence CACCCACACAGCCCGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961545502_961545508 -8 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545508 3:127630002-127630024 TGTGGGTGCGTGGCGGGCTGGGG 0: 1
1: 0
2: 3
3: 64
4: 806
961545502_961545506 -10 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545506 3:127630000-127630022 TGTGTGGGTGCGTGGCGGGCTGG 0: 1
1: 0
2: 5
3: 89
4: 1048
961545502_961545510 -2 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545510 3:127630008-127630030 TGCGTGGCGGGCTGGGGGTGTGG 0: 1
1: 0
2: 10
3: 97
4: 989
961545502_961545507 -9 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545507 3:127630001-127630023 GTGTGGGTGCGTGGCGGGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 608
961545502_961545513 14 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545513 3:127630024-127630046 GGTGTGGCACAGGTGTGAAAGGG 0: 1
1: 0
2: 0
3: 24
4: 212
961545502_961545512 13 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545512 3:127630023-127630045 GGGTGTGGCACAGGTGTGAAAGG 0: 1
1: 0
2: 2
3: 30
4: 283
961545502_961545511 4 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545511 3:127630014-127630036 GCGGGCTGGGGGTGTGGCACAGG 0: 1
1: 0
2: 4
3: 52
4: 498
961545502_961545509 -7 Left 961545502 3:127629987-127630009 CCGGGCGGCGGGCTGTGTGGGTG 0: 1
1: 0
2: 3
3: 22
4: 234
Right 961545509 3:127630003-127630025 GTGGGTGCGTGGCGGGCTGGGGG 0: 1
1: 0
2: 3
3: 73
4: 901

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961545502 Original CRISPR CACCCACACAGCCCGCCGCC CGG (reversed) Intronic
900103677 1:973339-973361 CACCCACACAGCCCCTGGCCTGG + Intronic
900148160 1:1167257-1167279 CTCCCACACAGCCCGCTCACCGG + Intergenic
900396687 1:2455888-2455910 CACGCACACAGCCCGCCCGCGGG - Intronic
900702126 1:4054999-4055021 CAAGCACACATCCCGCCTCCAGG - Intergenic
901168384 1:7236052-7236074 CTCCCCCACACCCCGCAGCCCGG - Intronic
903055535 1:20633653-20633675 CGCGGACACAGCCCGCCGCCGGG - Exonic
903508239 1:23853452-23853474 CCCCCGCCCAGCCAGCCGCCCGG + Intronic
904744695 1:32703283-32703305 CAGCCACCCAGCCCGCCCCCAGG - Intronic
906238885 1:44229417-44229439 CCCCCACCCAGCCTGCCACCAGG - Intronic
907682703 1:56579068-56579090 CAGCCACACACCCAGGCGCCCGG + Exonic
910788138 1:91022157-91022179 CACCCCCGCGGCCCGCAGCCCGG - Exonic
911450211 1:98053090-98053112 CACACACACAGCCCGCCAAGTGG - Intergenic
912432574 1:109636802-109636824 CACCCACACTGCCACCAGCCAGG - Intergenic
912633637 1:111270925-111270947 CACCCACACAGCCTGCGGGAAGG + Intergenic
912813172 1:112809317-112809339 CACCCACTCATCCCTCCTCCAGG - Intergenic
914846804 1:151287980-151288002 CAACCACTGCGCCCGCCGCCTGG + Exonic
915108512 1:153548767-153548789 CACCCACACACCCCACCGTGGGG + Intronic
915604416 1:156941654-156941676 CTCCCCCACAGCCTGCCACCTGG - Intronic
918522920 1:185434584-185434606 CAGCCACACACCACCCCGCCTGG + Intergenic
920234540 1:204494197-204494219 CCGCCGCTCAGCCCGCCGCCAGG + Intronic
920365945 1:205448493-205448515 CACCCACACTGCCTCCCTCCAGG + Intronic
921174509 1:212582448-212582470 AACCCACACAGCCCTCCCCTTGG - Intronic
922534406 1:226369257-226369279 CAGCCAGAAAGCCCGCTGCCTGG + Intronic
922958532 1:229625753-229625775 CACCCCCACCGCCCGCCGGCGGG + Intronic
923031127 1:230249701-230249723 CAACCAGAAAGCCCACCGCCCGG - Intronic
924801533 1:247332038-247332060 GACCCACAAAGCCCCCGGCCCGG - Intergenic
1068335774 10:55630883-55630905 CACCCACACATCCAGTCTCCGGG + Intergenic
1070774898 10:79103737-79103759 CGCCCACACAGCCTGGCTCCGGG - Intronic
1072527795 10:96289287-96289309 CACCCACAGAGCCCGCTCCATGG - Intergenic
1074923714 10:118046487-118046509 CACCCCCGCAGCCCTCCGCCCGG - Exonic
1076882385 10:133245839-133245861 CTCCCTCACAGCCCGCAGCTGGG - Intergenic
1077074945 11:696063-696085 CACCCACCCTGCCCGGGGCCAGG - Intronic
1077102883 11:829982-830004 CGTCCTCACAGCCCGCTGCCTGG - Exonic
1079371803 11:19859746-19859768 CCCCCACCCGGCCAGCCGCCCGG - Intronic
1079402726 11:20118751-20118773 CTCCCACACAGCCGGCCACAGGG + Intronic
1083426706 11:62591803-62591825 CAGCCACAAAGGCCGGCGCCGGG + Intronic
1083614463 11:64019390-64019412 CTCCCACACACCCCTCCTCCCGG + Intronic
1083627362 11:64078526-64078548 CACCCAGACAGCTCCCCTCCCGG - Intronic
1084412806 11:69013926-69013948 CCCCCCCACCGCCCGCCTCCAGG - Intergenic
1084604683 11:70165610-70165632 CACCCACACACCCCTCCGCCTGG - Intronic
1084937283 11:72593757-72593779 CAGCCACACAGCCCTGCACCTGG + Intronic
1084970346 11:72768131-72768153 TACCCTCACAGCCCACAGCCAGG + Intronic
1085315692 11:75543565-75543587 CACCCACAGAGCCAGCAGGCCGG - Intergenic
1087241774 11:95789358-95789380 CACCCATCCCGCCCGCCTCCCGG + Intronic
1087948659 11:104194710-104194732 CCCCCACCCGGCCAGCCGCCCGG + Intergenic
1088669683 11:112128952-112128974 CATCCACACAGCCCTCCTCGGGG + Intronic
1089573020 11:119422673-119422695 CCCGCACCCAGCCCGCCGCGAGG + Intronic
1089978270 11:122751497-122751519 CACCAACAGAGCCCACCTCCTGG + Intronic
1090801356 11:130174490-130174512 CACCCACACACCTCACCCCCAGG - Intronic
1091122016 11:133064742-133064764 CAGCCACACGGCCCGGCGCGGGG + Intronic
1091124604 11:133083155-133083177 CACGCACACACCCCGCCGAGCGG + Intronic
1091671826 12:2457433-2457455 CACCCACAACGCCCGCCCCTGGG + Intronic
1095986554 12:48003334-48003356 CACACACACACCACGCAGCCTGG + Intronic
1096148927 12:49296690-49296712 CAGCCCCGCTGCCCGCCGCCAGG - Intronic
1103012948 12:117471395-117471417 CACCCACCCAGCCAGTCTCCTGG + Intronic
1103377772 12:120469864-120469886 CATCCACACGGCCCGGCCCCAGG - Exonic
1103894931 12:124266649-124266671 CACCCCCACTTCCCGCCTCCTGG - Intronic
1104794991 12:131511131-131511153 CACCCTCACAGCCCGCCCCCAGG + Intergenic
1105987584 13:25583568-25583590 CATCCACACCGCCCGGCCCCTGG + Intronic
1109652917 13:65353093-65353115 CACCCACAAACCCAGCCTCCAGG + Intergenic
1109652941 13:65353200-65353222 CACCCACAAACCCAGCCTCCAGG + Intergenic
1109652966 13:65353307-65353329 CACCCACAAACCCAGCCTCCAGG + Intergenic
1110809007 13:79791338-79791360 CACCCACACATCCAGCCTCTAGG - Intergenic
1113643710 13:111976687-111976709 CACCCACCCAGGCCGCGCCCTGG - Intergenic
1117338506 14:54774961-54774983 CGCCCACAGAGCCAGCCGTCGGG - Exonic
1119163359 14:72471557-72471579 CACCCACACAGCCTGAGACCCGG - Intronic
1120204404 14:81572607-81572629 AACCCACACAGCCAGCTCCCTGG + Intergenic
1120980247 14:90283037-90283059 CAACCTCACAGCCCTCCTCCAGG + Intronic
1122144564 14:99681944-99681966 CACGCAGACAGCCCGCCCCAAGG + Intergenic
1122306761 14:100771321-100771343 CACCCAGCCAGCCCCCAGCCTGG - Intergenic
1122686653 14:103511436-103511458 GACGCTCACAGCCCGCCCCCAGG + Intergenic
1122817466 14:104320727-104320749 CACCCACACTGCCCTCCTCCGGG + Intergenic
1122848039 14:104511342-104511364 CACACACGCAGCCCACAGCCGGG + Intronic
1122863512 14:104593283-104593305 CACCCACCCAGTCCACTGCCAGG + Exonic
1123053533 14:105559144-105559166 CAGCCCCACACCCAGCCGCCGGG + Intergenic
1123078111 14:105679559-105679581 CAGCCCCACACCCAGCCGCCGGG + Intergenic
1125664182 15:41417200-41417222 CTCCCACGCCGGCCGCCGCCCGG - Exonic
1125709620 15:41774439-41774461 CGCCCACCCAGCCCGCGGCTTGG + Intronic
1132484130 16:181394-181416 CGTCCTCGCAGCCCGCCGCCCGG - Intergenic
1132664904 16:1077122-1077144 CAGCCCCACAGCCCCCAGCCAGG + Intergenic
1132899177 16:2244118-2244140 CACCCACACAGCCTCCACCCAGG + Intronic
1135466118 16:22686448-22686470 CACCCACTCAGCCACCCACCTGG + Intergenic
1136554327 16:30998782-30998804 CACCCACAGAGCCCTCCCCAGGG + Intronic
1138533399 16:57647053-57647075 CACCCACCCACCCAGGCGCCAGG - Intronic
1139546747 16:67653222-67653244 CACCACCACCGCCCGCCGCCGGG + Exonic
1139602249 16:67993750-67993772 CACCCACACAACCCAGCACCAGG - Exonic
1141883889 16:86878801-86878823 CAGGCACACAGAGCGCCGCCAGG + Intergenic
1142673635 17:1499733-1499755 CACACACACACCCCACCTCCAGG - Intronic
1142741990 17:1936779-1936801 CACCCGCACGGCCCCCGGCCCGG - Exonic
1142949268 17:3464903-3464925 CCCCCACCCGGCCAGCCGCCCGG + Intronic
1143259245 17:5585808-5585830 AGCCCACACAGCCCTCCTCCAGG - Intronic
1143782456 17:9236350-9236372 CACCCACACGGCACTCCACCAGG - Intronic
1144909839 17:18672165-18672187 CATGGAGACAGCCCGCCGCCGGG + Intronic
1144959969 17:19039459-19039481 CCCCCACACATCCCCCTGCCAGG + Intronic
1144975191 17:19135065-19135087 CCCCCACACATCCCCCTGCCAGG - Intronic
1145278809 17:21453814-21453836 CACACACACAGCCTGCGGCAAGG + Intergenic
1145294164 17:21574911-21574933 CACCCACATAGCCAGTCCCCAGG - Intergenic
1145369670 17:22298275-22298297 CACCCACATAGCCAGTCCCCAGG + Intergenic
1148331327 17:46815541-46815563 CCCCAACCCAGCCCCCCGCCTGG - Intronic
1148549410 17:48541805-48541827 CCCCCCCCCGGCCCGCCGCCCGG + Intronic
1149038543 17:52159683-52159705 CACCCACCCAGGCCGAGGCCAGG + Intronic
1152017827 17:77763476-77763498 CAACCCCACAGCTCGCCTCCAGG + Intergenic
1152599540 17:81255043-81255065 CACCCACACAGAGCTCCCCCTGG - Intronic
1158111994 18:53950436-53950458 CACACACACAGCCCTCAGTCAGG - Intergenic
1158695578 18:59700361-59700383 CTCCCATGCAGCCCGCAGCCTGG - Intergenic
1160610249 18:80078823-80078845 CACCCACACTGCACCCCACCAGG + Intronic
1160715669 19:575516-575538 CACCCCCACCGGCCGCAGCCAGG - Intronic
1160777215 19:861809-861831 CAACCACGCGGGCCGCCGCCCGG + Exonic
1160802195 19:975220-975242 CACCCACTCAGTACGCAGCCAGG - Exonic
1160827543 19:1087713-1087735 CACACACACAGTCCGCGGCCTGG + Exonic
1160831643 19:1107216-1107238 CACCCCCACACCCCCCAGCCAGG - Intergenic
1161022056 19:2015242-2015264 GACCCACCCAGCCTGCTGCCCGG - Intronic
1161232448 19:3181097-3181119 AATCCACACCACCCGCCGCCTGG + Intergenic
1161394508 19:4038133-4038155 CACCCACACAGCCGCCTCCCCGG + Exonic
1161556564 19:4945938-4945960 CATCCTCATAGCCCCCCGCCAGG - Exonic
1162042094 19:7977179-7977201 CACCCACAGAAGCCGGCGCCGGG - Intronic
1162057484 19:8073356-8073378 CACCCCCAGAGCCCTCCACCTGG + Intronic
1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG + Intergenic
1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG + Intergenic
1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG + Intergenic
1162167969 19:8767175-8767197 CACCCACACATCCCACAGGCAGG + Intergenic
1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG + Intergenic
1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG + Intergenic
1163779862 19:19240463-19240485 CCCCCACCCAGCCCACCTCCAGG + Intronic
1164621164 19:29696836-29696858 CACCCAGACACCCCACCACCTGG - Intergenic
1164621338 19:29697586-29697608 CACCCAGACACCCCACCACCTGG + Intergenic
1164621433 19:29697959-29697981 CACCCACAGACCCCACCACCAGG + Intergenic
1165828196 19:38717548-38717570 CACCCACACAACCCGTGGCAAGG - Intronic
1166394372 19:42427927-42427949 CACCCCCACCCCCCGCCCCCGGG + Intergenic
1168293907 19:55369743-55369765 CACACCCCCAGCCCGCCCCCCGG + Intronic
1168650324 19:58088312-58088334 CACACACAGAGCCCGACCCCAGG + Intronic
925161247 2:1685696-1685718 CACCCACTCAGCCGTCCCCCTGG - Intronic
926171692 2:10556733-10556755 CACGCGCACAGACCGCCCCCTGG + Intergenic
926672326 2:15587951-15587973 CACACACACACCCCTCAGCCTGG - Intergenic
928095777 2:28404242-28404264 CACCCCTACAGCCCCCTGCCGGG + Exonic
932771293 2:74502257-74502279 CACCCACACACCCCATCGGCGGG + Intronic
933974480 2:87497289-87497311 CACCCACCCAGGCTGCCCCCAGG + Intergenic
935111997 2:100103679-100103701 CACGCTCACAGCTCGCAGCCCGG - Intronic
935893732 2:107710463-107710485 CACACACACAGCCCCCCTGCAGG + Intergenic
936122975 2:109761472-109761494 CACGCTCACAGCTCGCAGCCCGG + Intergenic
936221711 2:110609992-110610014 CACGCTCACAGCTCGCAGCCCGG - Intergenic
936319344 2:111453530-111453552 CACCCACCCAGGCTGCCCCCAGG - Intergenic
936342114 2:111642959-111642981 CACCTACTCAGCCCGCCACAGGG - Intergenic
936521569 2:113215127-113215149 CACCTACAAAGCCAGCCCCCAGG - Intergenic
937230630 2:120396265-120396287 CACCCAGCCCGCCCTCCGCCAGG - Intergenic
938464033 2:131515340-131515362 CGCCCACACAGCCCACCCCGGGG - Intergenic
941808545 2:169733892-169733914 CACCCGAACAGCCCCCCGCACGG - Exonic
943185189 2:184598376-184598398 CCCCCGCCCACCCCGCCGCCGGG - Exonic
944263075 2:197696436-197696458 CCCCCACCCAGCCAGCCGCCCGG - Intronic
944467234 2:200015032-200015054 CAGGCACCCACCCCGCCGCCAGG + Intergenic
946167525 2:217874045-217874067 CACACACACAGCTAGCAGCCAGG + Intronic
946896858 2:224332992-224333014 CACACACACACCCCACAGCCAGG + Intergenic
947857053 2:233331223-233331245 CACCCAAACAGCCTGGCTCCAGG + Intronic
1168913223 20:1466691-1466713 ACCCGACACAGCCCGCCGCGCGG + Intronic
1171175339 20:23048000-23048022 CCCCCGCCCAGCCCGACGCCCGG - Exonic
1172905202 20:38364075-38364097 CACCCACGCAGCCCGGCCCCAGG - Intronic
1172986785 20:38997905-38997927 CACCCACAGACCCAGCCGCTGGG - Intronic
1173687267 20:44932382-44932404 CACCCACCCAGCCTGCCCCCAGG + Exonic
1174191913 20:48747001-48747023 CACACACACACCCCACCCCCAGG + Intronic
1175155477 20:56968199-56968221 TGCCCACACTGCCCGCCCCCAGG - Intergenic
1175470223 20:59222283-59222305 CACCCACCCCGCCGCCCGCCCGG - Intronic
1175966521 20:62662665-62662687 CAGCCACACACCCCGGAGCCTGG + Intronic
1176107549 20:63396479-63396501 ACCCCACACAGCCCTGCGCCTGG - Intergenic
1176122183 20:63458870-63458892 GACCCACACAGGCCCCCTCCCGG - Intronic
1176138107 20:63533888-63533910 CACCCAGACAGACCGGAGCCAGG + Intronic
1177978862 21:27885466-27885488 CACCCAGACCGCACGCCGGCCGG + Intergenic
1180613089 22:17110024-17110046 AATCCACACAGCCCGCTCCCAGG + Exonic
1181277358 22:21695231-21695253 CACCCACAGAGGCCCCGGCCAGG - Intronic
1181522888 22:23459637-23459659 CACCCACACAGCCCCAGGTCAGG - Intergenic
1182620323 22:31615142-31615164 GTCCCACACAGCCCCCTGCCTGG + Exonic
1183232996 22:36594568-36594590 CACCCACACACTCCCTCGCCTGG - Intronic
1183479871 22:38057596-38057618 CACCTACCCAGCCCCCCACCCGG + Intronic
1184651465 22:45921135-45921157 CACCCCCACTGCCCACGGCCTGG - Exonic
1184674776 22:46035828-46035850 CATCCGCACAGCCCGCGGCCTGG + Intergenic
1184695802 22:46138457-46138479 CACCTGCACAGCCCACCCCCGGG - Intergenic
1184778013 22:46632967-46632989 GACCCACACAGCCCCCCGCCCGG + Intronic
1185137081 22:49079305-49079327 CACTCGCACAGCCGGCTGCCAGG - Intergenic
1185320769 22:50199387-50199409 CCCGCACACAGACGGCCGCCGGG - Exonic
1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG + Intronic
949919648 3:8990765-8990787 GACACACACAGCCCGCCCCGGGG - Exonic
954384294 3:50236282-50236304 CCCCCACACGGCCCACGGCCCGG - Exonic
955350143 3:58187634-58187656 CACACACACACCCCTCTGCCAGG - Intergenic
957949142 3:87102017-87102039 CTCCCACACAGCCCACATCCTGG - Intergenic
958470184 3:94507587-94507609 CAGCCACCCAGCCCGCGCCCCGG + Intergenic
961361109 3:126367647-126367669 CACCCACCCAGCCCGATACCAGG + Intergenic
961545502 3:127629987-127630009 CACCCACACAGCCCGCCGCCCGG - Intronic
961976023 3:131026462-131026484 GGCCCTCACAACCCGCCGCCCGG + Intronic
966851947 3:184170140-184170162 CACCCATACAACCCGCACCCGGG + Exonic
967847577 3:194056497-194056519 CACCCACACAGCACACAGCAGGG - Intergenic
968703565 4:2067679-2067701 GGCCCACACAGCCCCCTGCCCGG - Exonic
969327140 4:6450613-6450635 CACCCACCCAGGCAGCTGCCTGG + Intronic
972412584 4:38808068-38808090 CCCCCACCCGGCCAGCCGCCCGG + Intronic
972765920 4:42152187-42152209 CACCCTCGGAGCCCGGCGCCCGG - Exonic
980339970 4:131532251-131532273 CTCCCACACAGCCCCACTCCGGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985653801 5:1119690-1119712 CACCCACACAGCCCCATCCCAGG + Intergenic
985686189 5:1282952-1282974 CACACATACAGCCCACCGCAGGG + Intronic
997614979 5:135240110-135240132 CGCCCACACAGCCCTCAGCCAGG + Intronic
999282105 5:150372704-150372726 CACCCACCCAGCCCCAGGCCTGG + Intronic
999445296 5:151633966-151633988 CACCCACAGAGCCTGACTCCAGG - Intergenic
999911791 5:156209708-156209730 CACCCACACATCCAGCCTCAAGG + Intronic
1000205186 5:159051436-159051458 CACCCCCCCACCCCGCCGCCCGG + Intronic
1001427135 5:171630152-171630174 CGCCCACCCAGCCCTGCGCCTGG - Intergenic
1002193959 5:177492361-177492383 AGCCCACACCGCCCACCGCCCGG + Intronic
1002796046 6:471611-471633 CTACCACCCAGCCCGCTGCCTGG - Intergenic
1004547351 6:16610886-16610908 CAGGCACACAGCCCCACGCCTGG - Intronic
1006063251 6:31441733-31441755 GCCCCACTCAGCCCGCAGCCTGG + Intergenic
1006128360 6:31854165-31854187 CCCCCACCCGGCCAGCCGCCCGG - Intergenic
1006861434 6:37174056-37174078 CACCTCCACAGCCTGTCGCCGGG + Exonic
1010245911 6:73660722-73660744 CCCCCGCCCAGCCAGCCGCCCGG - Intergenic
1011253740 6:85400437-85400459 CACTCACACAGCCCACATCCGGG + Intergenic
1013283825 6:108663573-108663595 CATGGAGACAGCCCGCCGCCGGG - Exonic
1013681250 6:112528267-112528289 CCCCCACCCGGCCAGCCGCCCGG - Intergenic
1017914320 6:158819479-158819501 CCCCCACCCAGCCCGAGGCCCGG - Intergenic
1018186916 6:161273618-161273640 CACCCACCCAGCCCCCTCCCGGG - Intronic
1019516080 7:1440797-1440819 CACCCCCACAGCCAGCCGGCCGG + Intronic
1019588437 7:1816900-1816922 CACCCACACAGCCCCAGGTCAGG + Intronic
1019833744 7:3359673-3359695 CATCCTCACAGCGCGCCACCCGG - Intronic
1020326508 7:6978524-6978546 ATCCCACACAGCCTGGCGCCTGG - Intergenic
1020364046 7:7360785-7360807 CACACACGCAGCCCACCTCCAGG + Intronic
1026856570 7:73758992-73759014 CACCCACAAAGCCCCCTGCCAGG - Intergenic
1026897980 7:74021601-74021623 CACCCACACAGCCGCCTGCAGGG - Intergenic
1027399993 7:77797739-77797761 CACCCACATAGCCCACGGCTGGG + Intronic
1034335917 7:150323436-150323458 CAGCCCCGCCGCCCGCCGCCTGG - Exonic
1034545392 7:151785684-151785706 CACCCACAGACCCCTCCGGCAGG - Intronic
1035386987 7:158479732-158479754 CACCCCCACAGGCAGCAGCCAGG - Intronic
1035406494 7:158602100-158602122 CACCCACAAAGCCCTAGGCCAGG + Intergenic
1035943251 8:3928772-3928794 CACCCACCCCGCCCACCCCCGGG + Intronic
1037003334 8:13747541-13747563 CCCCCACACAGATCGCCTCCTGG - Intergenic
1039451622 8:37679560-37679582 CACCCAGACACCCTGCCCCCTGG + Intergenic
1039566251 8:38554329-38554351 CACCCACTCAGCCCCCAGCTGGG + Intergenic
1040699344 8:50042287-50042309 CATCCCCACAGCCCACCCCCAGG + Intronic
1047024405 8:120811145-120811167 CACACACACACCCGGCCCCCTGG + Intronic
1049108798 8:140629973-140629995 AACCCACACAGCCCGGTTCCTGG + Intronic
1049438526 8:142598691-142598713 CCCCCACACCGCCCGTCGCCTGG - Intergenic
1049477967 8:142805691-142805713 CACCCACACCCCCTGCCTCCTGG + Intergenic
1049668803 8:143860548-143860570 CACCGCCGCCGCCCGCCGCCAGG - Exonic
1049669218 8:143862150-143862172 CACCGCCGCCGCCCGCCGCCAGG - Exonic
1053188250 9:36037079-36037101 CACCCGCACTGCCCGGAGCCAGG - Exonic
1053523316 9:38804425-38804447 CACCCACACACCCAGCCCCTAGG - Intergenic
1054195545 9:62028844-62028866 CACCCACACACCCAGCCCCTAGG - Intergenic
1054642862 9:67559845-67559867 CACCCACACACCCAGCCCCTAGG + Intergenic
1056488099 9:87079083-87079105 CACCCACCCTGCCCTCCGACAGG - Intergenic
1057995560 9:99819810-99819832 CACCCACTCACCCCGACCCCCGG + Intergenic
1061435010 9:130555564-130555586 CACCCACACTGCCTGCACCCAGG + Intergenic
1061843721 9:133375631-133375653 AACCCCCACAGCCCGCGCCCCGG + Intronic
1062222210 9:135422811-135422833 CACCCACCCAGCCCAGAGCCAGG + Intergenic
1062352965 9:136148167-136148189 CACCCACACTGCCCCCTGCCTGG + Intergenic
1062373666 9:136252558-136252580 GTCCCGCACAGCCGGCCGCCCGG + Intergenic
1062442760 9:136578508-136578530 CACAGACACAGCCTCCCGCCAGG - Intergenic
1062523390 9:136968864-136968886 CACCCCCACAGCCCAGCGCCCGG + Intergenic
1062565212 9:137161278-137161300 CACCTACCCAGCCCGCCACACGG + Exonic
1186044741 X:5523257-5523279 CAGCCACACAGCACCACGCCCGG + Intergenic
1186523791 X:10229093-10229115 CACCCATCCAGCCCTCCACCTGG - Intronic
1188294961 X:28435866-28435888 CCCCCACACACCCCTCCCCCGGG - Intergenic
1192737583 X:73863684-73863706 CACCTACACACCCAGCCTCCAGG + Intergenic
1193132338 X:77931924-77931946 CCCCCGCCCAGCCAGCCGCCCGG - Intronic
1196509686 X:116494296-116494318 CACACACACACCCCACCTCCCGG + Intergenic
1197736270 X:129851359-129851381 CCCCCACCCGGCCAGCCGCCCGG + Intergenic
1198967757 X:142245048-142245070 CACCCACACACCCAGCCTCCAGG + Intergenic