ID: 961551163

View in Genome Browser
Species Human (GRCh38)
Location 3:127671391-127671413
Sequence TTTCCTCAGCTGAGGTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961551163_961551168 2 Left 961551163 3:127671391-127671413 CCCCAGGACCTCAGCTGAGGAAA 0: 1
1: 0
2: 3
3: 24
4: 240
Right 961551168 3:127671416-127671438 GGCCCCTCCCACCCCTAGATTGG 0: 1
1: 0
2: 0
3: 24
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961551163 Original CRISPR TTTCCTCAGCTGAGGTCCTG GGG (reversed) Intronic
902740778 1:18436566-18436588 CTTCCTAAGCCAAGGTCCTGTGG + Intergenic
903007576 1:20308799-20308821 TGTCCCCAGCTGAGATCCTCAGG - Intronic
903458519 1:23504840-23504862 TTTCCTAGGCAGAGGACCTGCGG - Intergenic
907662922 1:56409646-56409668 TTTCCCCACCTGAGGCCTTGGGG - Intergenic
908755820 1:67468126-67468148 TTTTCTAAGCTGATTTCCTGAGG + Intergenic
909081585 1:71118882-71118904 TTTCATTTGCTGAGGTACTGTGG + Intergenic
912273373 1:108231931-108231953 TTTCTCCAGCTGAGCTACTGTGG + Intronic
912294847 1:108462391-108462413 TTTCTCCAGCTGAGCTACTGTGG - Intronic
912610840 1:111042073-111042095 TTTCCTATCCTGAGGTCTTGAGG + Intergenic
913444666 1:118937968-118937990 TTTCCACTGCAGAGGTCCTCTGG - Intronic
915069274 1:153252655-153252677 TTTCCTCTGCTGAGGTCTTGGGG - Intergenic
916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG + Intergenic
917623158 1:176818754-176818776 GCTCCTCAGCTGAAGCCCTGTGG + Intronic
919554079 1:199029706-199029728 TTTTTGCAGCTGAGGTCCAGAGG - Intergenic
920009649 1:202858697-202858719 TGTCCTCAGAAGAGGTCCTGGGG - Intergenic
922324096 1:224512438-224512460 TTGCCTCAGCTGAAGTGCAGAGG - Intronic
922754450 1:228087661-228087683 ACTCATCAGCTGAGGACCTGGGG + Intronic
922787893 1:228292271-228292293 TTTCTCCAACTGAGGTCCTCCGG + Intronic
1064042139 10:11976202-11976224 ATTTCTCAGCTGAGGTTCTTAGG + Intronic
1064261923 10:13792868-13792890 TTTCCTCTGCAGAGGCCCTGAGG - Intronic
1065732022 10:28718149-28718171 TTGCCTAAGCTGATGTGCTGTGG + Intergenic
1065847364 10:29757203-29757225 TTTCCTCTGCCGATGCCCTGTGG + Intergenic
1066156220 10:32680798-32680820 TTTTCTTAGCAGAGGTCCTTGGG + Intronic
1067090927 10:43265575-43265597 CTTCCTGGGCTGGGGTCCTGAGG + Intronic
1069184849 10:65409874-65409896 TTTCCTAGGCAGAGGTCCTGCGG + Intergenic
1069789673 10:71011633-71011655 CATCATCAGCTGAGTTCCTGAGG - Intergenic
1069801610 10:71085269-71085291 ATTCCCCTGCTGAGCTCCTGTGG + Intergenic
1071924393 10:90389197-90389219 GTTCCTCAACACAGGTCCTGGGG - Intergenic
1071967032 10:90862062-90862084 TATCCTAAGCTTATGTCCTGTGG - Intergenic
1075005637 10:118828014-118828036 TTTCCTCACCTCACTTCCTGGGG + Intergenic
1075223675 10:120605923-120605945 CTTGCCCAGCTGAGGGCCTGGGG - Intergenic
1075933247 10:126317410-126317432 TTTACTCAGCAGAGGTACTAAGG - Intronic
1076569150 10:131421024-131421046 ATTCCTCCGCTGGGGTCCTCAGG + Intergenic
1076662246 10:132063309-132063331 TTTCCTCAGAACACGTCCTGGGG + Intergenic
1076666523 10:132096061-132096083 TTTCCTCACCTGAAGAGCTGGGG + Intergenic
1078696393 11:13636622-13636644 TTTCTCCTGCTGAGGACCTGAGG + Intergenic
1078916508 11:15783675-15783697 ATTCCGCACCTGAGGGCCTGAGG + Intergenic
1080158693 11:29144801-29144823 ATTCCTCCTCTGAGCTCCTGAGG - Intergenic
1081013245 11:37842433-37842455 TTTTCCCATCTGAGGTCATGGGG - Intergenic
1083191971 11:61058576-61058598 GTTACTTTGCTGAGGTCCTGAGG - Intergenic
1083253106 11:61481193-61481215 TTTCCTCTGCAGAGGCTCTGAGG - Exonic
1084008887 11:66336905-66336927 TTTGCTTAACTGAGGTTCTGGGG + Intergenic
1084533499 11:69743262-69743284 CCTCCTCAGCTGGTGTCCTGTGG + Intergenic
1084899703 11:72300503-72300525 CTTCCTCAGCAGAGGTTCAGGGG + Intronic
1090745222 11:129699886-129699908 TTTTTTCAGATGAGATCCTGAGG - Intergenic
1091685477 12:2558463-2558485 TGTCCTCAGCTGAGGTATAGAGG - Intronic
1092916797 12:13196731-13196753 TTTCCTCTGCTGGTGTACTGGGG - Exonic
1094481444 12:30885521-30885543 TTACTTCAGCTCAGGTGCTGGGG - Intergenic
1096669102 12:53187746-53187768 TTTACAGAGCTGAGGTTCTGGGG - Exonic
1096669592 12:53190610-53190632 TTGCCTCTGCTGTGGCCCTGGGG + Exonic
1096807793 12:54150950-54150972 TCCCCTCACCTGAGGTGCTGAGG - Intergenic
1098878560 12:75892513-75892535 TCCCCTCTGCTGAGTTCCTGAGG - Intergenic
1099828918 12:87814894-87814916 TTTCCTAAGCTGAAGTGCAGTGG - Intergenic
1100244446 12:92743163-92743185 TTTCATCAGCAGAGGTCCCAGGG - Intronic
1101314610 12:103617754-103617776 TTACCTGAGCTGTTGTCCTGGGG + Intronic
1101917175 12:108904624-108904646 TTTCCACAGATGGGGTGCTGTGG - Intergenic
1102610436 12:114107022-114107044 TTTTCTCAGATGGGGTCTTGTGG + Intergenic
1102622788 12:114210043-114210065 ATTCCTCAGCTGGGGGCATGTGG - Intergenic
1104019259 12:124980744-124980766 CCTCCTCAGCTGAGGGCCAGCGG + Exonic
1106411040 13:29511650-29511672 CCTCTTCAGCAGAGGTCCTGAGG + Exonic
1106457184 13:29937667-29937689 TTTCCACAGATGGGGTCCGGGGG - Intergenic
1112342829 13:98566539-98566561 TTCCCTCAGCAGAGACCCTGAGG + Intronic
1113555083 13:111226967-111226989 CTTCCTAAACTGAAGTCCTGAGG - Intronic
1115525386 14:34274895-34274917 TTTCCTCAGCTGGGGAAATGAGG - Intronic
1117541058 14:56746850-56746872 TTTCCACAGCTGTGATCCTCAGG - Intergenic
1118868185 14:69719478-69719500 TTTCATCAGCTGTGAACCTGGGG + Intergenic
1121457854 14:94050256-94050278 TTCCCTTAGCTGAGCTCCTTGGG - Exonic
1122977262 14:105175946-105175968 TGACCCCAGCTGAGGTCTTGGGG - Intronic
1123478515 15:20610536-20610558 TTTGCCCAGCTGGGGTCTTGTGG - Intergenic
1123502322 15:20900358-20900380 TGTCCTCAGCTCAAGTGCTGTGG + Intergenic
1123559572 15:21474042-21474064 TGTCCTCAGCTCAAGTGCTGTGG + Intergenic
1123595808 15:21911339-21911361 TGTCCTCAGCTCAAGTGCTGTGG + Intergenic
1123639498 15:22389849-22389871 TTTGCCCAGCTGGGGTCTTGTGG + Intergenic
1124449529 15:29773643-29773665 TTTGATCAGAAGAGGTCCTGAGG + Intronic
1125142710 15:36428430-36428452 TGTCATCAACTGAGGTCCAGGGG - Intergenic
1125353568 15:38792736-38792758 TTTCTCCAGAAGAGGTCCTGGGG - Intergenic
1125398241 15:39272680-39272702 TTGCCCCAGCTGAGGTGCTGTGG + Intergenic
1125678262 15:41513884-41513906 TTTCCTCCTCTGGCGTCCTGGGG - Intronic
1129328819 15:74816396-74816418 TTCCCTGAGCTGAGGGGCTGGGG + Intronic
1129455079 15:75672437-75672459 GTTTCTAAGCTGGGGTCCTGGGG + Intergenic
1131072285 15:89473376-89473398 TTGCCCCATCTGTGGTCCTGGGG + Intronic
1132002224 15:98191843-98191865 CTTGCACAGCTGATGTCCTGGGG - Intergenic
1202967918 15_KI270727v1_random:201202-201224 TGTCCTCAGCTCAAGTGCTGTGG + Intergenic
1133256355 16:4518866-4518888 TTCCCACAGCAGAGGTGCTGGGG - Intronic
1134187907 16:12098891-12098913 CTTCCTCAGCTCAGCTCCTGTGG - Intronic
1134325012 16:13199564-13199586 TCTCCTCAGCTGCTTTCCTGTGG + Intronic
1137254315 16:46762476-46762498 TTCCGTCAGCTGGGGTCCTGCGG - Intronic
1139328981 16:66173085-66173107 TTTCCCAAACAGAGGTCCTGAGG + Intergenic
1141941394 16:87278416-87278438 ATTTCTCAGGTGAGGACCTGAGG + Intronic
1142345117 16:89548982-89549004 TTTCCCAAGCTGAAGCCCTGGGG - Intronic
1142692140 17:1613017-1613039 CCTCCTCAGCTGAGGTCCACAGG - Intronic
1145348186 17:22055180-22055202 TGTCCTGAGCAGAGGTCCTGGGG - Intergenic
1146096886 17:29938827-29938849 CTTCCTCCACTGAAGTCCTGGGG + Intronic
1146680814 17:34806701-34806723 TTTCCTCAACTGTGAACCTGGGG - Intergenic
1147257718 17:39191965-39191987 TAGACTCAGCTGAGGTCCAGTGG + Intronic
1148027416 17:44598395-44598417 TTTCCTCTGCTGTGCCCCTGAGG + Intergenic
1148062132 17:44844187-44844209 TTCCCACAGCTGAGATGCTGTGG + Intergenic
1149544687 17:57494694-57494716 TTTCCTCAGTTGAGGAACTGAGG + Intronic
1149591548 17:57833387-57833409 TTTAGGAAGCTGAGGTCCTGGGG - Intergenic
1150390693 17:64788404-64788426 TGGCCTCAGCTGTGGTCCAGGGG + Intergenic
1150801897 17:68289766-68289788 TTTCCTCAGTGGAACTCCTGAGG - Intronic
1151055613 17:71027595-71027617 TTTCCCCAGCTGGGGTGCAGTGG + Intergenic
1151953597 17:77369521-77369543 TTTCCTAAGATGAGGGGCTGTGG + Intronic
1152623144 17:81375900-81375922 TTTCCTCAGCTGAGTGCATGGGG - Intergenic
1154083650 18:11281224-11281246 TTTCCTTAGGTGAGGTGCTGGGG + Intergenic
1155232047 18:23783490-23783512 TGGCCTGAGCAGAGGTCCTGAGG + Intronic
1155776288 18:29766222-29766244 TCTCCTCATCTGTGGACCTGTGG + Intergenic
1156224886 18:35094864-35094886 TTTCCTCAACTCAGATACTGAGG + Intronic
1156550521 18:38011724-38011746 TTTTTTCAGCTGAGTTTCTGAGG + Intergenic
1158565814 18:58553386-58553408 TTCCCTGAGCTGGAGTCCTGAGG - Intronic
1160828435 19:1091458-1091480 TATCCTGAGCTGATGTCCAGGGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1160943487 19:1630723-1630745 ATTCCACAGCTGAGGCACTGGGG + Intronic
1161232762 19:3183101-3183123 CATCCTATGCTGAGGTCCTGGGG + Intergenic
1161977961 19:7616517-7616539 TTTGCTCAGCCGAGAGCCTGGGG - Exonic
1163344627 19:16732609-16732631 TTTTTTCAGATGAGGTCCAGTGG + Intronic
1163602691 19:18258322-18258344 TTACCTCTGCAGAGGGCCTGTGG + Intronic
1164513813 19:28917711-28917733 CTTCCCCAGCTGAGGTTCTGTGG - Intergenic
1165856207 19:38880563-38880585 ATTCCTCAGCTCAGAACCTGGGG - Intronic
1166411692 19:42559941-42559963 TTTGCCCAGATGAGGGCCTGGGG + Intronic
1167109951 19:47454345-47454367 TTCCCTCAACTGAGGGCATGTGG + Intronic
925271757 2:2614793-2614815 CTTCCTAAGCTGTGTTCCTGTGG + Intergenic
925273180 2:2629821-2629843 TATCCTGGGCTGAGTTCCTGTGG + Intergenic
926232882 2:11018318-11018340 TTTCCTTATGTGAGGGCCTGTGG + Intergenic
926254337 2:11177126-11177148 TTTACTCATCTGACGTCCTGAGG - Intronic
926276030 2:11403875-11403897 TTCCCACAGCTGAGGGCCAGTGG - Intergenic
926285205 2:11482658-11482680 CTTCCCCGGCGGAGGTCCTGGGG + Intergenic
927153053 2:20206481-20206503 CTTCCTTACCTGAGGTCTTGGGG - Intronic
930787387 2:55283799-55283821 TTTCCTCATCTCAGGACCTCAGG - Intergenic
931390457 2:61838689-61838711 TTTCCTCAAGTGATCTCCTGAGG + Exonic
931441369 2:62293072-62293094 TTTCCGCAGCTGGTGTACTGGGG + Intergenic
933703663 2:85273998-85274020 TGTTCTCACCTGAGGGCCTGAGG + Intronic
934621168 2:95808356-95808378 ATTCCACAGATGAGGTGCTGAGG - Intergenic
934812276 2:97290471-97290493 ATTCCACAGATGAGGTGCTGAGG + Intergenic
934825418 2:97417452-97417474 ATTCCACAGATGAGGTGCTGAGG - Intergenic
935602666 2:104938963-104938985 TTGCCCCAGCTGGAGTCCTGTGG + Intergenic
938848014 2:135231746-135231768 TTGCCTCAGCTGAAGTGCAGTGG - Intronic
939677969 2:145095849-145095871 TTTGCTCATATGAGGTCATGAGG + Intergenic
942040998 2:172062682-172062704 TTGCCACAGCTGAGCTCCAGAGG - Intronic
945969450 2:216221609-216221631 TCACCTCACCTGAGGACCTGTGG + Intergenic
947952687 2:234161652-234161674 TTTCCACAGATGGGGTGCTGAGG + Intergenic
948692950 2:239718482-239718504 TTGCCTAAGCTGAGATCCTGGGG - Intergenic
1171518710 20:25759563-25759585 TGTCCTGAGCAGAGGTCCCGGGG + Intergenic
1173225882 20:41162253-41162275 TTTGCTCAGATGAGGAACTGAGG + Intronic
1175550959 20:59817361-59817383 TATCCTCACCTGAGGGCCTAAGG - Intronic
1175701021 20:61137246-61137268 TTCCGTCAGCTCAGGTCATGGGG - Intergenic
1175907139 20:62386559-62386581 TCTCCTCTGCCGAGTTCCTGCGG + Intergenic
1176098105 20:63353430-63353452 TCTCCTGAGCTGTGGTCCTAGGG + Intronic
1176652859 21:9565968-9565990 TGTCCTGAGCAGAGGTCCCGGGG + Intergenic
1176893224 21:14344551-14344573 TTTCCTCAGCTGGAGTCCGTAGG - Intergenic
1177729899 21:25015285-25015307 TTTCCTCCCCGGAGGTCCAGGGG + Intergenic
1178705227 21:34867733-34867755 GTTCCCCAGCTGAGATCCTAGGG - Intronic
1178790351 21:35693862-35693884 TTTGCTCAGCTGTGGGCCAGTGG - Intronic
1180185862 21:46138887-46138909 TTTCCTCAGGTGTGTTCTTGGGG + Exonic
1182912814 22:34001586-34001608 TATCCCCAGCTGTGCTCCTGAGG + Intergenic
1183384557 22:37507605-37507627 TGGCCTCATCTGAGCTCCTGTGG - Intronic
1183983399 22:41555690-41555712 TTCCCCCAGCTGAGGTCCCTGGG - Intergenic
1184056918 22:42058902-42058924 TTTCCCCAGTTGATGTCTTGAGG - Exonic
1184505915 22:44902103-44902125 TGTCCTCAACTGAGGACCAGAGG - Intronic
949938334 3:9134808-9134830 TCTCCTCAGAGGAGGGCCTGAGG - Intronic
949947374 3:9201259-9201281 TTTCCTCACCTGAGGTCTTGGGG - Intronic
950544429 3:13630153-13630175 ATTCCCCTGCTGAGGTCCTGGGG + Intronic
952413014 3:33066121-33066143 TCTCCTCAGCTGAGCTCCTCAGG + Intronic
953200918 3:40777886-40777908 TTTCCTCCCTTGAGGTTCTGTGG + Intergenic
954391035 3:50267987-50268009 TTGCCCCAGCTGAGGGCCAGGGG + Intronic
954492052 3:50915707-50915729 GTGCTTCAGCTGAGGTACTGGGG + Intronic
954864591 3:53718156-53718178 TTAGCCCAGCTGAGGCCCTGAGG + Intronic
956282803 3:67576113-67576135 TTTCCACAGCAGAGTTTCTGTGG + Intronic
956849609 3:73216966-73216988 TTTCTTCATCTGTGGTCCAGTGG - Intergenic
958115401 3:89209967-89209989 TCTTCTGAGCTGAGTTCCTGGGG - Exonic
958852235 3:99342073-99342095 TTCCCTGAGTTGAGGTCATGTGG + Intergenic
960898691 3:122532525-122532547 TTTCCACATCTGTGGTCATGGGG + Intronic
961149168 3:124621768-124621790 CATATTCAGCTGAGGTCCTGAGG - Intronic
961551163 3:127671391-127671413 TTTCCTCAGCTGAGGTCCTGGGG - Intronic
961784775 3:129341210-129341232 TTTGGTCAGCGGTGGTCCTGGGG + Intergenic
962688941 3:137873393-137873415 TTTCCTAAGCAGAGGACCTTGGG - Intergenic
963260153 3:143184279-143184301 CTCCCTCAGCTGGGCTCCTGAGG + Intergenic
963607455 3:147423397-147423419 TTCCTTCAGCTGCTGTCCTGGGG + Intronic
967791553 3:193554876-193554898 TTTAGTCAGCTGAGGAGCTGCGG - Exonic
975662213 4:76699121-76699143 TTTTTACAGATGAGGTCCTGAGG + Intronic
976476262 4:85486210-85486232 TTTCATCAGCTGTGGTTTTGGGG + Intronic
978489593 4:109298444-109298466 TGACCTCAGCTCAGTTCCTGTGG - Intronic
979808624 4:125006835-125006857 TTTTCTCATCTGAGTTCCTCAGG + Intergenic
981688762 4:147482829-147482851 TCTACTCATCAGAGGTCCTGTGG - Intronic
983841722 4:172465036-172465058 TTTCCTCGGCTGAGGTTCTTTGG + Intronic
984799894 4:183704973-183704995 TCTCCATTGCTGAGGTCCTGTGG - Exonic
985547658 5:518176-518198 CTTCCTCCTCTGAGCTCCTGAGG - Intronic
985611476 5:892078-892100 TGTCCTCACCAGAGGCCCTGTGG + Intronic
985918594 5:2948236-2948258 TTTTCTCATCTGAAATCCTGTGG + Intergenic
988096777 5:26624196-26624218 TTACCACATCTGAGATCCTGAGG - Intergenic
988142255 5:27258857-27258879 GTTCCTTACCTGAGGTCCTGGGG + Intergenic
990342733 5:54839701-54839723 TTTCATCATCTGAAGTCCTCTGG - Intergenic
991051996 5:62282905-62282927 TTTCCTTTGCTGAGTTGCTGGGG - Intergenic
993307202 5:86288150-86288172 TTTCTCCAGCTGAGCTACTGTGG - Intergenic
996197851 5:120631868-120631890 GTGCATCAGCTGAGGTCCTATGG - Intronic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
1001567119 5:172706962-172706984 TTTCCCCAGCTCAGGTCCTGGGG - Intergenic
1002402302 5:178997510-178997532 TTTCCTCAGCTGGGCTGCTATGG + Intergenic
1003637097 6:7842324-7842346 GTGCCTCAGCTGAGGTGCTTGGG + Intronic
1003900785 6:10653575-10653597 TTTCCTATGCTGAGTTCCTTAGG - Intergenic
1004117885 6:12789007-12789029 TTGCATCAGCTGAGGTCATTTGG + Intronic
1004748443 6:18536422-18536444 TTCCCTCTGCTGATGTCATGTGG + Intergenic
1006151568 6:31992819-31992841 TGACCTCGGCTGTGGTCCTGGGG + Exonic
1006157869 6:32025557-32025579 TGACCTCGGCTGTGGTCCTGGGG + Exonic
1007351603 6:41277574-41277596 TTTCCTATGCTGAACTCCTGGGG + Intronic
1011685427 6:89819826-89819848 TTTCCGCCGCTGAGGGGCTGAGG - Intergenic
1012037447 6:94160693-94160715 TTTCCTCACCTGACTTCCTAAGG - Intergenic
1013594887 6:111651532-111651554 TAGCCCCAGCTGAGCTCCTGAGG + Intergenic
1014746189 6:125203658-125203680 ATTCCTGACCTGAGGTCATGTGG - Intronic
1015198337 6:130549518-130549540 TTGCCTCAGTTGAGGTCATGAGG + Intergenic
1015840532 6:137471960-137471982 TTTCCTCAGCTCTGGTTCTGTGG - Intergenic
1016897060 6:149063769-149063791 TTTCCACAGCTCAGCACCTGGGG - Intronic
1017738925 6:157387556-157387578 TGTCCTCTGGTAAGGTCCTGAGG - Intronic
1020547433 7:9550454-9550476 TTTCCTTAGCTAAGATCATGGGG - Intergenic
1021440568 7:20669597-20669619 TTTCCTAGGCAGAGGACCTGCGG - Intronic
1021811955 7:24411084-24411106 TTTCCTTAGCTGAAGTGCTTGGG - Intergenic
1023218551 7:37893666-37893688 TTTTCTCACCTGTGGTTCTGGGG + Intronic
1023611378 7:41974838-41974860 TGTCCTCAGCAAAGGTCCAGTGG + Intronic
1024213535 7:47227581-47227603 ATCCCCCAGCTCAGGTCCTGAGG - Intergenic
1024242276 7:47444889-47444911 TTTCACCAGCTCAGGTGCTGGGG - Intronic
1025279205 7:57614680-57614702 TGTCCTGAGCAGAGGTCCCGGGG + Intergenic
1025305526 7:57850820-57850842 TGTCCTGAGCAGAGGTCCCGGGG - Intergenic
1025606279 7:63042058-63042080 GTTACTCAGCTGGGGACCTGGGG + Intergenic
1025836450 7:65098622-65098644 TTTGTTCAGCTGAGGCCTTGGGG + Intergenic
1026223306 7:68419088-68419110 CTTCCTCAGCTGAGTGCATGCGG + Intergenic
1026224305 7:68427158-68427180 TTCCATCAGCTGACATCCTGGGG + Intergenic
1026303092 7:69115922-69115944 TGGCCTCTGCTGAGATCCTGTGG - Intergenic
1028073466 7:86481138-86481160 GTTCCTTTGCAGAGGTCCTGGGG + Intergenic
1029271698 7:99380863-99380885 TGGCCTCAGCTGGAGTCCTGGGG + Intronic
1032243230 7:130183055-130183077 TTTCCTCATCTGAAGTCCCTAGG - Intronic
1032512340 7:132481867-132481889 TTTCCTCACCCCTGGTCCTGTGG + Intronic
1032836636 7:135681323-135681345 TTTCTTGAGCTGTGGTGCTGAGG + Exonic
1033320372 7:140333597-140333619 CTCCCTCACCTGAGGTGCTGGGG - Intronic
1035174372 7:157039962-157039984 TTTCCTCAGTGGTGGTGCTGCGG - Intergenic
1039583033 8:38682420-38682442 TTACTTCAGCTGTGGTTCTGAGG - Intergenic
1040063754 8:43127705-43127727 TTACACCAGCTGGGGTCCTGAGG - Intergenic
1040404037 8:47082460-47082482 TTTCCTCTTTTGAGGTCCTGAGG - Intergenic
1041113239 8:54507329-54507351 ATTCAGCAGCTCAGGTCCTGGGG - Intergenic
1041211894 8:55559974-55559996 CTGCCTAAGCTGAGTTCCTGGGG - Intergenic
1041291442 8:56311963-56311985 TTCCCTAAGCAGAGGTCCTGGGG + Intronic
1042563337 8:70090113-70090135 ATTCCTCAGCAGAGGTCCTCGGG - Intergenic
1045997540 8:108381013-108381035 TTTCCTTAGCTGACATGCTGTGG + Intronic
1046682608 8:117187131-117187153 ACTCCTCAGCTGAGGACTTGAGG - Intergenic
1047782833 8:128123752-128123774 TATCCAGAGCTGAGGCCCTGCGG + Intergenic
1049216225 8:141409582-141409604 TGTTCTGAGCTGAGGTCCTCTGG + Intronic
1049804477 8:144532705-144532727 TTTCCCCAGCTGCCCTCCTGGGG + Intronic
1050200396 9:3139546-3139568 TATCCTAAACTCAGGTCCTGTGG - Intergenic
1053073579 9:35115136-35115158 TTCCCTAAGCTGAGGTCCCGGGG - Intronic
1053094582 9:35313583-35313605 TTGCCTCGGCTGAAGTGCTGTGG - Intronic
1056371788 9:85962897-85962919 CTTCCTCAGGTGAGGTACTTAGG - Intronic
1056787114 9:89601244-89601266 TGTCCTCAGCTGGGGTCTGGTGG + Intergenic
1058651576 9:107179879-107179901 TTTTTTAAGCTCAGGTCCTGAGG + Intergenic
1060405166 9:123369355-123369377 TTTACTCAGCTGAGATCTTCAGG - Intronic
1061368684 9:130185970-130185992 ATTCCCCAGCTCAGGTTCTGTGG + Intronic
1061621458 9:131813833-131813855 TTCCCTCAGCTGTGCTGCTGGGG - Intergenic
1061866372 9:133493605-133493627 GTTGCTCAGCTGCTGTCCTGGGG + Intergenic
1062465241 9:136677951-136677973 TTTCCTCTGCTGGGGTGCAGAGG - Intronic
1062592751 9:137281412-137281434 TTCCCTGAGCAGAGGTCCTGCGG + Exonic
1203630588 Un_KI270750v1:69509-69531 TGTCCTGAGCAGAGGTCCCGGGG + Intergenic
1186827343 X:13353533-13353555 TATCCTCATCGGAGCTCCTGAGG - Intergenic
1187446605 X:19366151-19366173 TTTCCTCTGCTGTTGTGCTGGGG - Intronic
1187576066 X:20556851-20556873 TTTCCTCTGCTGAGCTTCTATGG + Intergenic
1187815751 X:23229947-23229969 TTTCTCCAGCTGTGGGCCTGAGG + Intergenic
1190777085 X:53561628-53561650 TTTCCTATGCTGACTTCCTGGGG - Intronic
1195667142 X:107441657-107441679 TTTCCTGAGCAAAGGTCCTTGGG + Intergenic
1199488446 X:148373101-148373123 TTTCCTGAGCTGAAGTGCTTAGG + Intergenic
1199536211 X:148906134-148906156 GTTTCTGAGCTGAGGTCTTGAGG - Intronic
1200838120 Y:7752795-7752817 TTTCCTCAGTTGAGCCTCTGAGG + Intergenic