ID: 961551211

View in Genome Browser
Species Human (GRCh38)
Location 3:127671618-127671640
Sequence GTGTGGGGACAGGTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 813
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 727}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961551199_961551211 6 Left 961551199 3:127671589-127671611 CCGGCTGCCCAAGCTCAAGCACG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 80
4: 727
961551202_961551211 -2 Left 961551202 3:127671597-127671619 CCAAGCTCAAGCACGTGGTGAGT 0: 1
1: 0
2: 0
3: 4
4: 109
Right 961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 80
4: 727
961551197_961551211 30 Left 961551197 3:127671565-127671587 CCTGCTCTACAACTGCTGGCAGC 0: 1
1: 0
2: 0
3: 20
4: 321
Right 961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 80
4: 727
961551201_961551211 -1 Left 961551201 3:127671596-127671618 CCCAAGCTCAAGCACGTGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 132
Right 961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG 0: 1
1: 0
2: 5
3: 80
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961551211 Original CRISPR GTGTGGGGACAGGTGGGGCT GGG Intronic
900108214 1:994878-994900 GGGTAGGGACAGGTGGAGCTGGG - Intergenic
900119752 1:1043469-1043491 GTGAGGGGTCTGGTGGGGGTCGG + Intronic
900149417 1:1171643-1171665 GTCAGGTGGCAGGTGGGGCTGGG - Intergenic
900154119 1:1197320-1197342 GTGTGGGGAAGGTTGGGGCAGGG - Intronic
900157153 1:1207735-1207757 GGGTGGGGCCAGCTGGGCCTGGG + Intergenic
900160756 1:1222372-1222394 GGGTGGGGCCGGGTGGGGCCCGG - Intronic
900175101 1:1288059-1288081 GTGCGGGGGCAGGTGAGGCTGGG + Intronic
900251880 1:1675192-1675214 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900262291 1:1738048-1738070 GTGGGGAGACAGGTGGGGGCTGG - Intronic
900344907 1:2205883-2205905 GTGTGCGGACAGGTGGGCCGGGG - Intronic
900869113 1:5289275-5289297 GTGGGAGCACAGGTGGGGCCAGG - Intergenic
900977272 1:6025580-6025602 TTGAGGGGACAGGTGGCCCTGGG - Intronic
901020387 1:6252394-6252416 TGGTGGGGAGAGGCGGGGCTGGG - Intronic
902133252 1:14281966-14281988 GTGTGGGGAGCTGGGGGGCTGGG - Intergenic
902698236 1:18154661-18154683 ATGTGGGGAGGGGTGGGGGTGGG + Intronic
902996504 1:20229572-20229594 GTTTGGGGGACGGTGGGGCTGGG + Intergenic
903218080 1:21854170-21854192 GTGAGGAGCCAGGTGTGGCTGGG - Intronic
903778846 1:25809234-25809256 GTGGGAGGAGAGGTGGAGCTGGG - Intronic
904016350 1:27424328-27424350 GTGGGGGCACAGGTAGGGATAGG - Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904318532 1:29681580-29681602 GTGCAGGGACAGGTGGGGTGGGG + Intergenic
904319786 1:29689445-29689467 GGGTGGGCACAGCTGGGGATGGG - Intergenic
904377040 1:30088183-30088205 GTGAGGACACAGGTGGTGCTGGG + Intergenic
904827265 1:33281658-33281680 GTGCGGGCACTTGTGGGGCTTGG - Exonic
905239270 1:36571721-36571743 GGGTGGGGACAGCTGGGCTTAGG - Intergenic
905634608 1:39541618-39541640 GTGTGGTGACAAGGGAGGCTGGG - Intergenic
905788129 1:40774242-40774264 GTCTGGGGACAGCTGGTGGTTGG + Intergenic
906063263 1:42962055-42962077 GTGTGTGGGCAGGTGGGGTGGGG - Intergenic
906063518 1:42963411-42963433 GGGTGGGGACAGGAAGGGATGGG - Intergenic
906237566 1:44221211-44221233 GAGGGGGCACAGGAGGGGCTTGG + Exonic
906956982 1:50382170-50382192 GTGTGGGGAGAGGTGGACATGGG + Intergenic
907115393 1:51963746-51963768 GTTTGGGCACAGGTGCAGCTTGG - Intronic
907372081 1:54010253-54010275 GTCTGGGCACAGGCTGGGCTGGG - Intronic
907488681 1:54794991-54795013 GGCTGGGGCCAGGTGGGGCGGGG - Intronic
910201243 1:84701865-84701887 GTGTGGGGGGGGGTGGGGGTTGG + Intergenic
910899143 1:92100949-92100971 GTGGGGGAACAGGTGGTGTTTGG + Intronic
912332758 1:108834705-108834727 GGGACGGGACAGCTGGGGCTGGG - Intronic
912703860 1:111897586-111897608 ATGTGGGGCCAGGTAGGGCAGGG + Intronic
913046592 1:115078467-115078489 GTGTGAGGATATGTGGGGTTGGG + Intronic
913089171 1:115465050-115465072 GTGAGGGGAGAGATGAGGCTGGG - Intergenic
915226939 1:154418542-154418564 GGTTGCGGACAGGTGGGGCTGGG + Intronic
915579898 1:156807268-156807290 GGGTGGGGGCTGGTGGGGCAGGG + Exonic
915904818 1:159870081-159870103 AAGTGGGGACTGGTGGGGTTAGG - Intronic
915907200 1:159887722-159887744 GTGTGGGCAGGGGTGGGGCGGGG - Intronic
915973907 1:160372562-160372584 GTGTCAGGACAGGTGGATCTGGG - Exonic
917280739 1:173376347-173376369 GGGTGGGGACATGTGGTGTTTGG - Intergenic
917433902 1:174999887-174999909 GGGCGGGGAGGGGTGGGGCTAGG + Exonic
918777241 1:188649459-188649481 GTGCGGGGAGAGGTGGGGGCAGG - Intergenic
919241874 1:194925023-194925045 GGGTGATGACAGGTGTGGCTAGG - Intergenic
919435642 1:197556201-197556223 TTGTGGGGAAAGGTGGGAGTGGG + Intronic
919768221 1:201140887-201140909 ATGTGGGGAAACATGGGGCTGGG - Intronic
920591450 1:207222695-207222717 GTGTGTGGAGGGGTGGGGATGGG + Intergenic
921255477 1:213335034-213335056 TTATGGGGAGAGGTGGGGCGCGG - Intergenic
921316894 1:213900522-213900544 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
921850562 1:219928598-219928620 GTGCGGGGACTGGTGGCGCTCGG - Exonic
922348451 1:224716623-224716645 GTGTGGGGACCGTGGGGGTTTGG + Intronic
922890745 1:229059975-229059997 GTGAGGGGAGAGGTGGGACTGGG + Intergenic
924112061 1:240710031-240710053 GTGTGGGGACAGGAAGGTGTGGG - Intergenic
1063009778 10:2011161-2011183 GAGTGAGCACAGGTGGGGCTCGG + Intergenic
1063199504 10:3774323-3774345 GGGTAGGGATAGGTGGGGGTGGG + Intergenic
1063547840 10:6999516-6999538 GTGTATGGGAAGGTGGGGCTGGG + Intergenic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1064788680 10:18929693-18929715 TTGTTGGGACTGGTGGGGTTGGG + Intergenic
1065177868 10:23096003-23096025 GTGGGGGCATAAGTGGGGCTCGG + Intronic
1066638802 10:37534666-37534688 GTGGAGGGCCAGGTGGGGCTCGG + Intergenic
1067092622 10:43276640-43276662 GTCTGGGGGTGGGTGGGGCTGGG - Intergenic
1067201133 10:44172890-44172912 TTGTGGGGACTGCGGGGGCTTGG + Intergenic
1067342825 10:45418702-45418724 CTGTGGGCACAGGTGTGGCGAGG + Intronic
1067450900 10:46381260-46381282 GGGTGGGGATAGGTGAGCCTTGG + Intronic
1067501057 10:46805768-46805790 GAGTGGGAAGTGGTGGGGCTTGG + Intergenic
1067543568 10:47175643-47175665 GTTTGGAGACAGGCAGGGCTAGG - Intergenic
1067555581 10:47267674-47267696 GTGTGGGGGTGGGTGGGGGTGGG - Intergenic
1067586343 10:47478491-47478513 GGGTGGGGATAGGTGAGCCTTGG - Intronic
1067593524 10:47534147-47534169 GAGTGGGAAGTGGTGGGGCTTGG - Intronic
1067640633 10:48042251-48042273 GAGTGGGAAGTGGTGGGGCTTGG - Intergenic
1070288808 10:75101762-75101784 GTGTGGGGAGGGGTGGGGTTTGG - Intronic
1070604755 10:77890897-77890919 GGGTGTGGACAGGTTAGGCTGGG - Intronic
1071479777 10:86056523-86056545 GAATGGGGACAGGTGGGAGTAGG - Intronic
1071572886 10:86707786-86707808 GGCTGGGGAAAGGTTGGGCTTGG - Intronic
1071775757 10:88786229-88786251 GTGTGTGTACATGTGGGGCCAGG - Intergenic
1072166516 10:92818593-92818615 CTATGGGGGCAGGTGGGGTTGGG + Intergenic
1072188049 10:93060813-93060835 GAGGAGGGACAGGTGGGGCGGGG + Intergenic
1072360573 10:94654962-94654984 GGGTGATGACAGGTGTGGCTGGG - Intergenic
1072537885 10:96377099-96377121 CAGTGGGGTCAGGTGGGCCTCGG + Intronic
1072549772 10:96468736-96468758 GTGCAGGGCCAGGTGGGGCAAGG - Intronic
1072631465 10:97149726-97149748 GTTTGGGGTCAGGTGGGCCTGGG + Intronic
1073073860 10:100811123-100811145 GTGTGTGGAGAGGTGGGGGAGGG + Intronic
1073289198 10:102405099-102405121 GGGTGGGAATAGGAGGGGCTGGG - Intronic
1073458670 10:103652997-103653019 AGCTGGGGACAGGTGGGCCTTGG - Intronic
1073510625 10:104040369-104040391 CTGGGGGGCCAGGTGGGCCTGGG + Exonic
1073592733 10:104772047-104772069 GTGTTTCGATAGGTGGGGCTTGG + Intronic
1074772045 10:116741229-116741251 GGGTGGGGGCAGGTGCGGCTTGG + Intronic
1075015030 10:118904154-118904176 GTGTGGGGCTAGGCAGGGCTGGG - Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075257948 10:120940015-120940037 GAGTGGGGTGGGGTGGGGCTGGG - Intergenic
1075401594 10:122164779-122164801 AAGTGGGGGCAGGTGAGGCTGGG - Intronic
1075678842 10:124318121-124318143 ATGTGTGGACAGGTGGGGTGCGG - Intergenic
1075728589 10:124623215-124623237 GTGTGGGCCCAGGCAGGGCTGGG - Exonic
1075777812 10:124999374-124999396 GGGTGGGGACAGATTGGGGTGGG + Intronic
1075815855 10:125264328-125264350 GTTTGGGGAGAGCTGGTGCTGGG + Intergenic
1076238912 10:128887443-128887465 GTGTGGGCACAGGTGTGGATTGG - Intergenic
1076445724 10:130512541-130512563 TTGTGGGCACAGGTGGAGTTAGG + Intergenic
1076520382 10:131077324-131077346 GGGTGGGGATAGGTTGGGCAGGG + Intergenic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1076595584 10:131623031-131623053 GTGGGGGGAGAGGTGGGGAGAGG + Intergenic
1076631572 10:131855150-131855172 GCCTGGGGGCAGGTGGGGCTGGG + Intergenic
1076706727 10:132306433-132306455 GTGTGGGGCCTGGTGTGGCTGGG + Intronic
1076716471 10:132366772-132366794 GTGTGGGGACAGGAAGGCCAGGG - Intronic
1076854372 10:133108785-133108807 GTGAGGGGAGGGGTGGAGCTGGG - Intronic
1076854423 10:133108938-133108960 ATGAGGGGACGGGTGGAGCTGGG - Intronic
1077052217 11:572049-572071 GTGTGGGTAGCGGTGGGGGTGGG + Intergenic
1077069154 11:659955-659977 AGGTGGGGCCAGGTGGGGCTTGG + Intronic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077114238 11:875986-876008 GTGTGGGGGCATGTGAGGCTGGG + Intronic
1077119256 11:899315-899337 GAGTGGGCACAGGTGGTGGTGGG - Intronic
1077169493 11:1159870-1159892 GTGTGGGGCTGTGTGGGGCTGGG + Intronic
1077191163 11:1256459-1256481 GGGCGGGGATGGGTGGGGCTCGG - Intronic
1077191184 11:1256506-1256528 GGGCGGGGACGGGTGGGGCTGGG - Intronic
1077221989 11:1421950-1421972 GAGAGGGGGCAGGTGGGGGTGGG + Intronic
1077262669 11:1631161-1631183 ATGTGGGGAGAGGTGGGGAGAGG + Intergenic
1077282916 11:1753701-1753723 GTGGGGGGGCGGGTGGTGCTAGG - Intronic
1077339739 11:2020970-2020992 GCGGGGCCACAGGTGGGGCTGGG + Intergenic
1077576165 11:3385499-3385521 GTGTGGGGTCAGGTGGTTATGGG - Intergenic
1077911192 11:6572185-6572207 GTGTGGGTACAGTTGGGGTGGGG + Intronic
1078057185 11:8018396-8018418 GGGTGGGGAGGGGTGGGGCAGGG - Intergenic
1078438625 11:11345685-11345707 GTGTGGGTACAGGGATGGCTTGG + Intronic
1078894314 11:15584607-15584629 GTGTAGGGTGAGGCGGGGCTGGG + Intergenic
1078930249 11:15906911-15906933 GTGTGGGGGCAGGTGTGTGTGGG - Intergenic
1079224724 11:18595440-18595462 ATGTGGGGTCAGGTGGGGGTGGG - Intergenic
1081647618 11:44800753-44800775 GATTGGGGACAGGTGGGGGCAGG + Intronic
1081810211 11:45910212-45910234 GTGTGGGGAGGGGTGGGGCAGGG - Intronic
1083263540 11:61535839-61535861 GGGGAGGGAAAGGTGGGGCTGGG + Intronic
1083294357 11:61707193-61707215 GTGTGGTGGGAGGTGGAGCTGGG - Intronic
1083554317 11:63613973-63613995 GTGCGGGGCGAGGCGGGGCTGGG - Intronic
1083581656 11:63828869-63828891 GTGGGGGCACAGGTGGGACTTGG + Intergenic
1083735410 11:64677517-64677539 GGGCAGGGACAGGTGGGGCAAGG - Intronic
1083830118 11:65226033-65226055 GTCTGGGGTGAGGTGGGGATGGG + Intergenic
1084009886 11:66341506-66341528 GCGTGGGGACACCTTGGGCTGGG - Intronic
1084164960 11:67371279-67371301 GAGTGGGGACACATGGGCCTGGG + Intronic
1084179729 11:67440324-67440346 GTCTGCGGCAAGGTGGGGCTGGG - Exonic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1084308037 11:68299267-68299289 GCTTGGGGACTGGAGGGGCTTGG + Intergenic
1084329564 11:68422761-68422783 ATGTGGGGGTAGGTGAGGCTGGG - Intronic
1084431437 11:69113663-69113685 GTGTGGGGAAAGGAGGGGCCGGG - Intergenic
1084570816 11:69958798-69958820 ATGTCGGGACTGGTGGGGGTGGG + Intergenic
1084676283 11:70637403-70637425 AGATGGGGGCAGGTGGGGCTGGG + Intronic
1084678172 11:70649024-70649046 GTCTGGGGACAGGAGGGGTGTGG + Intronic
1084938977 11:72602256-72602278 GAACAGGGACAGGTGGGGCTGGG + Intronic
1085049160 11:73371065-73371087 GTGTGGGGGAAAGTGGGGCTTGG + Intergenic
1085301531 11:75461822-75461844 AGTTGGGGACAGCTGGGGCTTGG - Intronic
1088830605 11:113533158-113533180 CTGTGGGGCCACGTGGGGGTGGG - Intergenic
1089171006 11:116511464-116511486 GTGTGGGGGCAGGTCGCTCTTGG + Intergenic
1089454554 11:118618381-118618403 GAGTGGGGCCAGGCAGGGCTGGG - Intronic
1089560070 11:119339428-119339450 GTGTGGGTGCAGGTGGGTGTGGG - Exonic
1089615382 11:119692039-119692061 GGGAGGGAGCAGGTGGGGCTGGG - Intronic
1090263125 11:125336223-125336245 TTGTGGGGAGAGGTGAGGGTAGG - Intronic
1090305055 11:125684132-125684154 ATGTGGCGGCAGGTGGGGCGGGG + Intergenic
1090883370 11:130854304-130854326 GTGAGGGGACAGGGGTGGCATGG + Intergenic
1091165572 11:133472930-133472952 GTGTGTGGGCAGGTGGGGTTGGG - Intronic
1091203508 11:133800934-133800956 GTGTGGGGGCAGTAGGGGATGGG - Intergenic
1202822724 11_KI270721v1_random:76159-76181 GCGGGGCCACAGGTGGGGCTGGG + Intergenic
1091405847 12:209077-209099 GTGAGGAGGCAGGTGTGGCTGGG - Intronic
1091917285 12:4278760-4278782 GAGTGGGAACTGGTGGTGCTGGG + Exonic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1092373475 12:7936255-7936277 GGGTGGGGTGGGGTGGGGCTGGG - Exonic
1092700478 12:11223769-11223791 TTGGGGGGACAGGTGGTGTTTGG - Intergenic
1092709663 12:11322437-11322459 GTGTGGAGACAGATGGGCCCAGG - Intergenic
1092887549 12:12938281-12938303 GTGTTGGAACAGGTTGGGCGCGG + Intergenic
1092936303 12:13367254-13367276 CTGTAGGGCCAGGTGGGGCCTGG - Intergenic
1093934647 12:24987840-24987862 GTGTGGGCACAGGTGCAGATGGG - Intergenic
1094282821 12:28759327-28759349 GTATGGAGTCAGGTGGGGATGGG + Intergenic
1094507537 12:31074170-31074192 GTGTGGGGACGGGTAGGCCTAGG + Intronic
1096226321 12:49868939-49868961 GGGTGGGGAGGGATGGGGCTGGG + Exonic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1101017738 12:100519369-100519391 CTGTGGGGCTGGGTGGGGCTTGG + Intronic
1101038629 12:100731414-100731436 ATGTGGGGACAGGAGGGTTTGGG - Intronic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1101693750 12:107105564-107105586 GTGAAGGGACTGGTGGGGGTTGG - Intergenic
1101718543 12:107331889-107331911 AGGTGGGGAGAGGTGGGGCGGGG - Intronic
1102277974 12:111598165-111598187 GGGTGGAGACAAGTGGGCCTTGG - Intronic
1102570212 12:113822878-113822900 GGGTGGGGACAGGGGGAGCAGGG + Intronic
1102590783 12:113955366-113955388 GTCTGGCCAGAGGTGGGGCTAGG + Intronic
1102764461 12:115420400-115420422 GTTTGGGGTCAGCTGGGCCTTGG - Intergenic
1102816569 12:115870594-115870616 GTGGGGGGAGGGGTGGGGCGGGG + Intergenic
1103004248 12:117408752-117408774 GCGTGGGGACAGCTGGGCCCAGG - Intronic
1103909065 12:124342010-124342032 GGGTGGGTACAGGTGCGGGTAGG + Exonic
1103928271 12:124435644-124435666 GTGTGTGGGCACGTGGGGCCAGG - Intronic
1103992831 12:124810584-124810606 GTGAGGTGAGAGGTGGGGCGCGG + Intronic
1104110585 12:125700638-125700660 TGGTGGGTAGAGGTGGGGCTGGG + Intergenic
1104597741 12:130131640-130131662 GTGTGGGCACAGATGGTGCCAGG - Intergenic
1104859498 12:131917063-131917085 GTGTGTGGGTGGGTGGGGCTCGG + Intronic
1104921227 12:132291793-132291815 GTGTGGGGACAGGAGGGGATGGG - Intronic
1104971891 12:132534533-132534555 GTGTGGGCACATGTGGGGCAGGG - Intronic
1105543788 13:21337442-21337464 GTCTGGGGACAGGTGACCCTGGG - Intergenic
1105722936 13:23134763-23134785 GTGGGTGGACAGGGGGAGCTGGG - Intergenic
1107764823 13:43723041-43723063 GTGTGGGGACAGTTTGGGAAGGG - Intronic
1107908755 13:45085681-45085703 GTGTGGGGGCAGGTGGTGGATGG - Intergenic
1108007229 13:45961546-45961568 GGGTGGGGAGATGTGGGGGTGGG + Intronic
1108007236 13:45961562-45961584 GGGTGGGGAGATGTGGGGGTGGG + Intronic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1108617039 13:52143378-52143400 GTGTGGGGACAGGTGGTATATGG - Intronic
1109644431 13:65235031-65235053 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1109939901 13:69348132-69348154 GTGTGAGAACAGGTGGTGTTTGG - Intergenic
1110075285 13:71232641-71232663 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1110722716 13:78782906-78782928 GAGTGGGGAAAGTGGGGGCTTGG + Intergenic
1112434277 13:99380358-99380380 GTGTGGGGACTGGGCGTGCTGGG + Intronic
1112569262 13:100579311-100579333 CTGTGGGGAGAGGAGGGCCTAGG + Intronic
1112899174 13:104338389-104338411 CTGTGGAGTAAGGTGGGGCTGGG - Intergenic
1113769610 13:112899665-112899687 GTGTGAGGACACCTGGGGCCAGG - Intronic
1113800156 13:113082358-113082380 GTGGGGGGGCAGGTGGGCCAGGG - Intronic
1114517448 14:23308968-23308990 GTCCAGGGCCAGGTGGGGCTAGG + Exonic
1114614259 14:24059924-24059946 GGGTGGGAACAGGTGAGGATGGG - Intronic
1115012990 14:28572897-28572919 GTGGGGGGACAGGGTGGTCTTGG + Intergenic
1115501555 14:34054226-34054248 GTGAGGGGAGAGTTGGGGCTGGG - Intronic
1115611286 14:35050903-35050925 GCCTGGGGATTGGTGGGGCTTGG + Intronic
1117298614 14:54401651-54401673 TTGGGGGGACAGGTGGTGTTTGG + Intronic
1117460500 14:55940289-55940311 ATGTGGGGACAGGCTGGGCTGGG - Intergenic
1117533997 14:56686824-56686846 TTTTGGGGACAGATGGGGCCAGG - Intronic
1117750242 14:58914432-58914454 GTGTGAGGCCAGTTCGGGCTAGG - Intergenic
1117812724 14:59565803-59565825 ATCTGGGGACGGGTGGGGCGAGG - Intronic
1118157432 14:63255556-63255578 GGCTGGGGGGAGGTGGGGCTGGG - Intronic
1118972833 14:70651978-70652000 GAGTGGGGACAGTTGGGACCAGG + Intronic
1119400592 14:74359725-74359747 GTGTGGGACCAGGTGGGGCAAGG + Exonic
1119514475 14:75237217-75237239 GTGTGGGGTCAAGTTTGGCTGGG - Intergenic
1119568404 14:75648255-75648277 GTGTGGGGAAGGGCTGGGCTGGG + Intronic
1119852330 14:77874976-77874998 GTCCAGGGACAGGAGGGGCTTGG + Intronic
1119857897 14:77914540-77914562 GTGTGGGAGAGGGTGGGGCTGGG + Intronic
1120627919 14:86852420-86852442 ATGTGGGCTCAGGTGAGGCTGGG - Intergenic
1120919795 14:89744509-89744531 GGGTGATGACAGGTGTGGCTGGG - Intergenic
1120921942 14:89763417-89763439 GTGTGGGGACAGTGGGGGAAGGG - Intergenic
1120996693 14:90423178-90423200 GTGTGGTGACAGGTGGGCATGGG + Intergenic
1121278561 14:92684639-92684661 GTGTGGGGAAAGGGGTGGCCAGG - Intronic
1121501678 14:94443035-94443057 GTTTGTGGGCAGGTGGGGGTAGG - Intronic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1122603690 14:102933761-102933783 CTGTGGGGGGAGTTGGGGCTCGG + Exonic
1122768583 14:104086953-104086975 GGGTGGGGATAGGAGGGGCGGGG - Intronic
1122795059 14:104201853-104201875 GTGGTGGGCCAGGTGGGGCTGGG - Intergenic
1122974692 14:105166269-105166291 GTGTGGGGGCAGGGAGGTCTTGG - Intronic
1123058649 14:105584422-105584444 GTCTGGGGACAGTGGGGTCTGGG + Intergenic
1123075635 14:105666174-105666196 GTGTCGGGACAGGAGGGGACAGG + Intergenic
1123082978 14:105704648-105704670 GTCTGGGGACAGTGGGGTCTGGG + Intergenic
1123123112 14:105927191-105927213 GGCTGAGGACAGGCGGGGCTGGG - Intronic
1123405750 15:20018609-20018631 GGCTGGGGACAGGCAGGGCTGGG - Intergenic
1123410693 15:20056462-20056484 CTGTGGGGACAAGTGGTCCTAGG - Intergenic
1123515080 15:21025257-21025279 GGCTGGGGACAGGCAGGGCTGGG - Intergenic
1123520022 15:21063168-21063190 CTGTGGGGACAAGTGGTCCTAGG - Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124639964 15:31391367-31391389 GTGTGGGGTCTGTGGGGGCTGGG + Intronic
1124844698 15:33279115-33279137 CTGACGGGACAGGTGAGGCTGGG + Intergenic
1125519649 15:40340704-40340726 AGCTGGGGACAGCTGGGGCTGGG - Intronic
1125579004 15:40772774-40772796 AGGTGGGGACAGGTGTGGCCAGG + Intronic
1125598759 15:40904055-40904077 GTGTGGGGGCATGTAGGGCCTGG - Intergenic
1125602440 15:40923046-40923068 CTGAGGGGGAAGGTGGGGCTGGG + Intergenic
1125731063 15:41893095-41893117 ATGGGAGGACAGGTGAGGCTGGG - Intronic
1125834069 15:42735635-42735657 GGGGTGGGACAGGTGGGGGTAGG + Exonic
1125967612 15:43886941-43886963 GTGTGGGTGCAGGCAGGGCTGGG + Intronic
1128154936 15:65386098-65386120 GTAAGGGGTCAGGCGGGGCTGGG + Intronic
1128229335 15:66023958-66023980 GGATGGGGACAGCTAGGGCTGGG + Intronic
1128377873 15:67090109-67090131 GGGTGGTGACAGGTGGCACTGGG + Intronic
1128944975 15:71813809-71813831 GTGAGGGGACAGGGCAGGCTGGG + Intronic
1129107863 15:73321638-73321660 GTGTGGTGAGAGGTCAGGCTGGG + Exonic
1129142384 15:73611840-73611862 GTGTGGGGACAGGGGGTACATGG + Intronic
1129249702 15:74302215-74302237 GGGTGGGGACAGCTGGGGAAGGG - Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1129595113 15:76957838-76957860 GGGTGGAGCCAGGTGGGGGTTGG - Intergenic
1129677771 15:77641710-77641732 CTGTGGAGTCAGGTGGTGCTGGG + Intronic
1129720171 15:77873509-77873531 GTCTGGTGACAGCTGGGGCCAGG + Intergenic
1129831845 15:78675826-78675848 GTGTGTGTATGGGTGGGGCTGGG + Intronic
1129869555 15:78931858-78931880 GGTTGTGGACAGGTGGGGGTAGG - Intronic
1130175547 15:81565433-81565455 GTGTGTGAGCAGGTGGGGCCGGG - Intergenic
1131104882 15:89726852-89726874 GTGTGGGGGGCGGTGGGGCAGGG - Intronic
1131400262 15:92119655-92119677 GGGTGGGAAGAGGAGGGGCTAGG + Intronic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132605363 16:791467-791489 GTGTGGTGACGTGTGGGTCTTGG + Intronic
1132670407 16:1100162-1100184 GTGTGTGAGCAGGTGGGGCAGGG - Intergenic
1132730350 16:1357958-1357980 CTGTGGGGAAGGCTGGGGCTTGG - Intronic
1132794695 16:1713969-1713991 ACCTGGGGACAGGTGGGGCAAGG - Intronic
1132899209 16:2244223-2244245 GTGTTGAGAAAGGTGGGCCTCGG - Intronic
1132909276 16:2299972-2299994 CTGTGGGGACAGGGAGGGCCGGG - Intronic
1133056292 16:3147145-3147167 GTGGGAGGCCAGGTGGGGCAGGG + Intronic
1133115356 16:3575430-3575452 GACTGAGGACAGGTGGGACTCGG + Intronic
1133238948 16:4403396-4403418 CTGTGCTGACAGGTGCGGCTTGG + Intronic
1133326629 16:4945935-4945957 GTGTGAGGTGAGGTGGGGCAGGG - Intronic
1133457257 16:5953364-5953386 ATTTGGGGACAGGTGGTGTTTGG + Intergenic
1133802258 16:9092738-9092760 GTGTGAGGACCGGGGGGGCAGGG - Intronic
1133830764 16:9321402-9321424 TTGTGAGCACAGGTGGGGCAAGG + Intergenic
1134106834 16:11491650-11491672 GTGTGGGCAGGGGTGGGGCTGGG - Intronic
1134717193 16:16363064-16363086 GTGGGGGGGCAGGGGGTGCTTGG - Intergenic
1134957558 16:18389095-18389117 GTGGGGGGGCAGGGGGTGCTTGG + Intergenic
1135302022 16:21338635-21338657 GTGTGGGGCCAGATGGGCCTCGG + Intergenic
1135689032 16:24521576-24521598 TTGTGGGGAGTGGTAGGGCTTGG - Intergenic
1135772325 16:25227007-25227029 GTGTGAGGTGAGGTGGGGTTTGG + Intronic
1136116360 16:28097404-28097426 GGGTGGGGATGGGTGGGACTTGG - Intergenic
1136361145 16:29780524-29780546 GTGTGGGGGCATCTGTGGCTGGG + Exonic
1136782658 16:32917148-32917170 GTGAGGGAAAGGGTGGGGCTGGG - Intergenic
1137981321 16:53072509-53072531 GGGTGGGGTGAGGTGGGGTTGGG - Intronic
1138081271 16:54093526-54093548 GAGTGGGGTCAGCTGGGACTGGG - Intronic
1138457869 16:57131718-57131740 GTGAGGGGCCAGGAGGGGCCAGG - Intronic
1138474661 16:57263710-57263732 GGGTGGGGGTAGGAGGGGCTGGG - Intronic
1138515422 16:57533275-57533297 GTGTGGGAAGGGGTGGGGGTCGG + Intronic
1138597265 16:58035686-58035708 CTCTGGGGACAGGTGGAGCTAGG - Intronic
1139423555 16:66864486-66864508 CGGTGGGGACATGTGGGGCTTGG - Intronic
1139507090 16:67404200-67404222 ATGTGGGGAGAGGTGGGGCGGGG + Intronic
1139844169 16:69907645-69907667 GTGTGGGGATAAGTGGTCCTTGG + Intronic
1140315361 16:73891223-73891245 CTGGGGGGAGAGGTGGGGATTGG - Intergenic
1140469583 16:75206710-75206732 ATGTGTGGGCAGCTGGGGCTTGG - Intronic
1140487072 16:75301928-75301950 GTGAGTGGAGATGTGGGGCTGGG + Intronic
1140808007 16:78551646-78551668 GGGCGGGGGCAGGTGGGGCGGGG - Intronic
1141644582 16:85360368-85360390 GGGTGGGGGCAGGTGGGGCAGGG + Intergenic
1141722680 16:85765576-85765598 GTGGGGGCAGAGGTGGGGGTGGG + Intergenic
1142122117 16:88391621-88391643 CTCTTGGGACAGGTGGGGCCGGG + Intergenic
1142157201 16:88538000-88538022 GTGGGGAGACAGGTGGGCTTGGG - Intergenic
1142258060 16:89024851-89024873 CTGTGTGCACAGGTGGGCCTCGG - Intergenic
1142281994 16:89153647-89153669 GTGGGTGGGCAGGTGGGGCAGGG - Intronic
1142291029 16:89193607-89193629 GTGAGGGGGCAGGTGTGGGTGGG + Intronic
1142380196 16:89727577-89727599 GTGGCGGGAGAGGAGGGGCTGGG + Intronic
1142416261 16:89944627-89944649 TTGTGGGGACAGGTGGGGGACGG - Intergenic
1142732158 17:1866999-1867021 GAGTGGGAAGATGTGGGGCTAGG + Intronic
1142848680 17:2694100-2694122 GTGTGTGGCCAGGTGGGGCTGGG - Intronic
1143022832 17:3925586-3925608 TTGGGGGGTCCGGTGGGGCTGGG - Intronic
1143091974 17:4454268-4454290 GTTGGGGGACAGGCAGGGCTGGG - Intronic
1143113864 17:4569875-4569897 GTGTAGGAGCAGGTGGGGGTTGG - Intergenic
1143514395 17:7412095-7412117 TTGTGGGGAAAGATGGGGGTCGG - Intronic
1143965346 17:10752940-10752962 GGGTGGGGTTGGGTGGGGCTGGG + Intergenic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144140108 17:12340123-12340145 GTGTGGGGACTGGTGGGTGAGGG - Intergenic
1144144836 17:12387472-12387494 GTCTGGGCACAGGTGGAGCCTGG + Intergenic
1144834378 17:18149219-18149241 GTTTGGGAACAGCTGGGACTCGG + Exonic
1145867437 17:28250183-28250205 GTGTGGGGTGAGGTGGGGGAAGG + Intergenic
1146009099 17:29179998-29180020 GTGTGGGGGGATTTGGGGCTTGG - Intronic
1146111039 17:30089742-30089764 GTGTGTGGGCAGTTTGGGCTGGG - Intronic
1146677871 17:34785930-34785952 GGGTGGGGACTTCTGGGGCTGGG - Intergenic
1146745144 17:35322004-35322026 GGGTGTGGAGAGGTGGGGTTAGG - Intergenic
1146944575 17:36864917-36864939 GTCATGGGACAGGAGGGGCTGGG - Intergenic
1147168244 17:38604599-38604621 GCATGGGGACGCGTGGGGCTGGG + Intronic
1147597280 17:41725209-41725231 GTGTGGAGACGGGTGGGGGTGGG - Intronic
1147605519 17:41771932-41771954 GTGGGAAGACAGGCGGGGCTTGG - Intronic
1147989287 17:44323436-44323458 GGGTGGGGGCGGGTGGGGATGGG - Intronic
1147993642 17:44349968-44349990 GGGTGGGGAGAGGTCGAGCTGGG + Intronic
1148050462 17:44767655-44767677 GTGCCGGGGCAGCTGGGGCTGGG - Intronic
1148129454 17:45254268-45254290 CTCTGGGGGCAGGTGGAGCTGGG + Intergenic
1148222201 17:45870967-45870989 GGTTGGGGAGAGGTGGGGGTCGG - Intergenic
1148612580 17:48974144-48974166 TAGTGGGGACAGGTGGAGCTGGG - Intergenic
1148761113 17:50001086-50001108 GTGTGGGGAGAGCTGGGGGGAGG + Intergenic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1149302555 17:55318401-55318423 ATGTGTGGACAGGTGAGGCTGGG + Intronic
1149545467 17:57500324-57500346 CTTTGGGGGCAGGTGGGACTTGG + Intronic
1149568467 17:57655486-57655508 GGGTGGGGAGAGGTGGGACGGGG - Intronic
1149891229 17:60392044-60392066 GTGTGGGGGGAGGTGGGGGCGGG - Exonic
1150182140 17:63134129-63134151 TTGTGGGGAGAGGTGGGGAAAGG + Intronic
1150390352 17:64786517-64786539 GTGTGGCGAAGGGTAGGGCTGGG + Intergenic
1150865865 17:68849396-68849418 GTGTGGGGAAGGGTGGGGAAAGG + Intergenic
1151226793 17:72654039-72654061 GTGTGCGGAAGGGTGGGGCATGG + Intronic
1151389468 17:73776120-73776142 GAGCGGGGACAGGTGGTCCTGGG + Intergenic
1151576296 17:74954089-74954111 GTGTGGATACTGGTGTGGCTGGG - Intronic
1152097123 17:78278795-78278817 GGGTGGGGGCAGGTGGAGCTGGG - Intergenic
1152477150 17:80525899-80525921 CTGTGGGTACAAGTGGGGCAGGG - Intergenic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1152710546 17:81868791-81868813 GTATGGGGAGGGGAGGGGCTGGG + Exonic
1152744850 17:82033920-82033942 CTGTGGGGAGCGGTGGGGGTGGG + Exonic
1152821812 17:82441326-82441348 GTGAGGGGGCAGGTGTGGGTGGG + Intronic
1152930771 17:83108522-83108544 GTGTGGGCACTGGTGGGCGTAGG + Intergenic
1153999962 18:10474461-10474483 GTGAGGAGGCAGGTGCGGCTGGG + Intronic
1154009919 18:10565589-10565611 GTGTGTGGACATGAGGGGCGGGG - Intergenic
1154172254 18:12060694-12060716 GTGTGGGGACTGGTCGGTCGGGG + Intergenic
1154177571 18:12094779-12094801 GTGTGGGGGTGGGTGGGGTTGGG + Intronic
1154318493 18:13325449-13325471 GTGTGGTGCCAGGTGGGTCTGGG - Intronic
1154354718 18:13616238-13616260 GTGGGAGGACAGGTGGGGGGGGG + Intronic
1154355522 18:13621065-13621087 GGGTGGGGACTGGAGGGGCCAGG + Intronic
1156228751 18:35133885-35133907 GTGTGGGGTCGGGTGGTGATGGG - Intronic
1156475501 18:37403106-37403128 GTGAGGGGAGAGATGGGGCGAGG + Intronic
1157391845 18:47309709-47309731 ATGTGGGGGCAGGTGAAGCTGGG + Intergenic
1157581599 18:48777117-48777139 GGGTGGGGAGAGTTGGGGATGGG - Intronic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1159856775 18:73598340-73598362 GTGTGGCCATAAGTGGGGCTTGG + Intergenic
1160223323 18:76992798-76992820 GTGGGAGGAGAGCTGGGGCTGGG - Intronic
1160529181 18:79553623-79553645 GCGTGGGGACAGCTGTGGCATGG - Intergenic
1160583787 18:79901757-79901779 GTGTGGAGACAGGCGGTTCTTGG - Intergenic
1160777132 19:861525-861547 GTGGGGGTGCAGGTGGGGATGGG - Intronic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1160785985 19:900511-900533 GTGTGGGGCCAGGATGGGGTAGG - Intronic
1160862986 19:1245429-1245451 GTGTGTGGACGGCGGGGGCTGGG + Intergenic
1160875885 19:1295988-1296010 GTGTGGGGCCAGGGGGGAGTGGG + Intronic
1161009955 19:1955211-1955233 TTGTGGGGGCAGGGGGAGCTGGG + Intronic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161065216 19:2234139-2234161 GCGTCGGGCCAGGTGGGGCCAGG - Exonic
1161324963 19:3659143-3659165 GAGTGGGGACAGGTAGGGTTCGG - Intronic
1161346768 19:3772131-3772153 GGGTGGGCACTGGTGGGCCTGGG - Intronic
1161562600 19:4981706-4981728 AGGTGGGAAGAGGTGGGGCTTGG - Intronic
1161638484 19:5404455-5404477 GTTTGGGGCCAGGTGGGATTTGG - Intergenic
1161683667 19:5692871-5692893 GTCTGGGGACAGGCAGGGATGGG + Intronic
1161745325 19:6056017-6056039 GTGGGGGGGCAGGTGGCGGTGGG + Intronic
1161753522 19:6114710-6114732 GTGCGGGGACAGGTGGGGTGGGG + Intronic
1161851871 19:6741313-6741335 TTGTGGGGAAAGGCGGTGCTTGG + Intronic
1162070023 19:8147768-8147790 AGGTGGGGCCAGGTGGGGCCAGG + Intronic
1162378295 19:10317656-10317678 GGGTGGGGACATGCAGGGCTGGG - Intronic
1162452378 19:10762883-10762905 GGGTGGGGGCAGGTGGGGGATGG + Intronic
1162612571 19:11767603-11767625 GGGTGTGGACAGGGGCGGCTGGG + Intronic
1162726737 19:12694571-12694593 GTGAGGAGTCAGGTGGGGATAGG - Intronic
1162793855 19:13076751-13076773 GGGTGGAGCGAGGTGGGGCTGGG + Intronic
1162918635 19:13887538-13887560 GTTTGGGGCCAGGTGTGCCTAGG - Intronic
1162943554 19:14028612-14028634 GTCTGAGGACAGGTGGGGGCGGG + Intronic
1163126766 19:15248427-15248449 GGGTGGGGTGAGGTGGGGTTGGG + Intronic
1163463733 19:17454742-17454764 CTCTGGGGGCAGGAGGGGCTGGG - Intronic
1163691699 19:18742028-18742050 CCGTGAGGAGAGGTGGGGCTGGG - Intronic
1164273850 19:23699679-23699701 GTGTGTGGGCAGGTGGGGAGGGG - Intergenic
1164456789 19:28414502-28414524 GTAGTGGGACAGGTGGGGCAGGG - Intergenic
1164532068 19:29056346-29056368 GTTTGTGGCCAGGTGGCGCTCGG - Intergenic
1165258698 19:34595810-34595832 AGGTGGGGACAGCTGGGGGTGGG + Exonic
1165320224 19:35080437-35080459 GCGTAGGGGCAGGTGGGCCTGGG - Intergenic
1165432436 19:35780511-35780533 GGGCGCGGACAGGTGGGGCTGGG + Intronic
1165486710 19:36100976-36100998 GAGTGGGGACAGTTGAGGCCTGG + Intronic
1166301522 19:41914204-41914226 GTGTGGGAACAGAGGGGGCCTGG - Intronic
1166346307 19:42168237-42168259 GTGTGGGGACAGGACAGGATGGG - Intronic
1166714536 19:44958276-44958298 GTGAGGGGAGAGGGGTGGCTGGG + Intronic
1166760368 19:45220658-45220680 GGGAGGGGAGAGGTGAGGCTGGG + Intronic
1167117655 19:47497581-47497603 GGGTGGGTACAGGAGGGGCCAGG - Intronic
1167465895 19:49651040-49651062 ATCGGGGGGCAGGTGGGGCTGGG - Exonic
1167528692 19:50001443-50001465 GTGTTGGGCCAGGAGAGGCTGGG - Intronic
1167783137 19:51613546-51613568 GTATATGGACAGGTGGGGCCGGG - Intronic
1168069975 19:53943619-53943641 GGGTGGGGACAGGGTGGGGTGGG + Exonic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168349724 19:55669032-55669054 GTGCGGGGAGAGGTGGGGTCAGG - Intronic
1168641512 19:58034399-58034421 GGGCGGGGACTGGGGGGGCTGGG + Intronic
1168692447 19:58385373-58385395 GTGTGGTTGCAGGAGGGGCTAGG - Intergenic
925363244 2:3294399-3294421 GTGTGTGGAGAGGATGGGCTGGG - Intronic
925732115 2:6926593-6926615 GTGTGGGTACAGTGTGGGCTGGG + Intronic
925962686 2:9033450-9033472 GTGTGGAGAAAGGTGAGACTTGG + Intergenic
926091768 2:10055835-10055857 GAGTGGGGACAAGTGGCCCTAGG + Intergenic
926406567 2:12559036-12559058 GTTTGGCCACTGGTGGGGCTCGG - Intergenic
927100424 2:19783773-19783795 GTGTGGGGGCAGTGGGGGCAGGG - Intergenic
927651231 2:24914898-24914920 GTGTGGGATGGGGTGGGGCTGGG - Intronic
927680714 2:25137282-25137304 GGATGGGGACAGGAGGGGCAAGG - Intronic
927937500 2:27083909-27083931 GTCGGGGGACAGGCGGGCCTGGG + Exonic
928069338 2:28198898-28198920 TTGTGAGGACAGGTGGGGGCAGG - Intronic
928076071 2:28265866-28265888 GACTGGGAACAGGTGGGGATGGG - Intronic
928077861 2:28281459-28281481 GGGAGGAGACTGGTGGGGCTCGG - Intronic
928080078 2:28303686-28303708 GAGTGGGGAGAGGTGGGAATTGG - Intronic
928391064 2:30911429-30911451 GTGTGATGGCAGGAGGGGCTGGG + Intronic
928429000 2:31202395-31202417 GAGTGAGCAGAGGTGGGGCTGGG + Intronic
929573509 2:43038479-43038501 GAGTGGGGAGAGGAGGGGCGGGG - Intergenic
930269619 2:49241047-49241069 GTGTGGAGACAGGCTGGCCTGGG + Intergenic
931201981 2:60106323-60106345 GTGTGTGCAAAGGTGGGGGTGGG - Intergenic
931785691 2:65617643-65617665 GTGTTGGGGCAGATGGGGGTGGG - Intergenic
932567200 2:72917563-72917585 GTGCGGGGACACCGGGGGCTGGG + Exonic
934728416 2:96640039-96640061 GGGTAGGGAGAGGTGGGGCAGGG - Intronic
934756834 2:96830239-96830261 GTGGTGGGGCAGGTGGGGGTGGG - Intronic
934971575 2:98768582-98768604 GTGTGGGAGAAGGTCGGGCTGGG + Intergenic
935121452 2:100186663-100186685 GTGTGGGGGCAGGTGGGCAAAGG + Intergenic
935788580 2:106570796-106570818 CTGAGGGAAAAGGTGGGGCTCGG + Intergenic
935833823 2:107028055-107028077 GTGTGGGGATAAGTGTTGCTTGG - Intergenic
935979791 2:108615462-108615484 GTGGGGGGTATGGTGGGGCTAGG + Intronic
936059291 2:109283947-109283969 GTGTGGGGACAGGAGGGAGGCGG - Intronic
936388969 2:112055099-112055121 GTGTGGGGACAGGGCAGGGTTGG - Intergenic
936514123 2:113171078-113171100 GTGTGGGAAAAGATGGGGCCAGG - Intronic
936525836 2:113241164-113241186 GAGTGGCCAAAGGTGGGGCTAGG + Intronic
936805897 2:116332028-116332050 GAGTGAGGACATGTGGTGCTTGG + Intergenic
937004794 2:118501445-118501467 GTGGTGAGGCAGGTGGGGCTGGG + Intergenic
937252620 2:120534133-120534155 GTATGGGCACAGGCAGGGCTGGG - Intergenic
937299647 2:120831402-120831424 GTGTGGGGACAGGTTGTCCAGGG + Intronic
937301335 2:120844433-120844455 TAGTGGGTGCAGGTGGGGCTTGG + Intronic
937415366 2:121710359-121710381 GTGGGGGAGCAGGTGGGGGTGGG + Intergenic
937615162 2:123913453-123913475 GTGTGGTGTCAGGTGGGTCTGGG - Intergenic
937797388 2:126039942-126039964 GTGTGTGGGCAGGGGGAGCTGGG - Intergenic
937923003 2:127145629-127145651 CTGTGGGGCCAAGAGGGGCTGGG + Intergenic
938071687 2:128311758-128311780 GTGTGGGTGCAGGTGGGTCTAGG - Intronic
938318428 2:130345884-130345906 GTGTGTGATGAGGTGGGGCTTGG - Exonic
938323352 2:130380567-130380589 GTGTTGGGACAGGGCAGGCTGGG + Intergenic
938343129 2:130548615-130548637 GTGTGGGGTGGGGTGGGGTTGGG + Intronic
938346704 2:130572107-130572129 GTGTGGGGTGGGGTGGGGTTGGG - Intronic
938677798 2:133656564-133656586 GTGTGGGGACAGGAGGAGAGGGG - Intergenic
940174558 2:150864030-150864052 GAGTGGGCCCAGGTGTGGCTTGG - Intergenic
943090963 2:183374516-183374538 GTGTGGGGGGGGGTGGGGGTGGG + Intergenic
944192142 2:197014893-197014915 GTGTGTGGAGAGGTGGGGTGGGG - Intronic
945852755 2:215029398-215029420 GTGTGGGGAAAGGTGAGGAGAGG - Intronic
946156159 2:217808159-217808181 GTCTGGGCATGGGTGGGGCTGGG - Intronic
946159232 2:217826031-217826053 GGGCAGGGCCAGGTGGGGCTGGG - Intronic
946276516 2:218635733-218635755 GAGTAGGGTCGGGTGGGGCTGGG + Intronic
946405369 2:219489436-219489458 GTGTGGGGGCAGCAGGAGCTAGG - Exonic
946420775 2:219563332-219563354 GTGGGGGGCCAGGTGGGCCTCGG - Intronic
947335647 2:229080026-229080048 GGGAGGGGACAGGTGAGGCGGGG + Intronic
947796531 2:232896943-232896965 GTGAGGGTACAGGTGAGGATGGG + Intronic
948156849 2:235790448-235790470 GTGTGGGGAGCGGAGGGGCTGGG - Intronic
948807866 2:240460757-240460779 GTAGGGGCACAGGTGGGCCTTGG - Intronic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
949071989 2:242030954-242030976 GTGTGGGGCCAGGCTGGGGTCGG - Intergenic
1168799567 20:635477-635499 GTGGGGGGAGTGGTGGTGCTGGG + Intergenic
1168872968 20:1146633-1146655 GTGGGGGGAGAGGTGGGGCAGGG - Intronic
1169404672 20:5313876-5313898 GTGGGGTGAGTGGTGGGGCTGGG - Intronic
1169528151 20:6453362-6453384 GTCTGGGGAGCTGTGGGGCTGGG - Intergenic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1171489257 20:25504964-25504986 GTGTGGGAAGAGCTGGGGGTGGG - Exonic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172273900 20:33669583-33669605 CTGATGGGACAGGTTGGGCTGGG - Intronic
1172643530 20:36455872-36455894 GTGAGGGGACAGGTGGGCCCAGG - Intronic
1173159669 20:40643117-40643139 CTCTGGGGCCAGATGGGGCTGGG + Intergenic
1173427863 20:42958333-42958355 GGGAGGGGAGAGGAGGGGCTGGG + Intronic
1173578965 20:44132829-44132851 GTGTGGGGGGCGGTGGGGGTGGG - Intronic
1174391500 20:50220862-50220884 GTGTGGGGCCAGGAGGGGTGAGG + Intergenic
1174485407 20:50857982-50858004 GTGTGGGGACGGGATGGGCATGG - Intronic
1175400986 20:58699744-58699766 CAGTGGGGAAAGGTGGGTCTGGG - Intronic
1175402160 20:58707033-58707055 GCGTGGGGCCGGGTGGGGGTGGG + Intronic
1175472416 20:59240113-59240135 CTGTGGGGGTAGGTGGGGGTGGG - Intronic
1175563631 20:59954736-59954758 GTGTGTGGGCAGGGGAGGCTTGG + Intergenic
1175863048 20:62160289-62160311 GGGTGGGGAGAGGTGGGGTGGGG + Intronic
1175967242 20:62665808-62665830 TTGGGGGGACAGGTGGGGAGGGG - Intronic
1175967255 20:62665837-62665859 GTGAGGGGACAGGTGGAGAGGGG - Intronic
1176137449 20:63530432-63530454 GTGTGGGGACCGGAGGGCCCGGG + Intronic
1176241904 20:64079310-64079332 GGGTGGGGGCAGGAGGGGCCAGG + Exonic
1176920206 21:14679142-14679164 GTGTGGGTAGGGGTGGGGATTGG - Intergenic
1177131861 21:17267632-17267654 GTTTGTGGACAGGTGGGACAGGG - Intergenic
1177823074 21:26053012-26053034 GTGTGGGGACAGGGGGTACACGG + Intronic
1178415762 21:32403793-32403815 GGCTGGGGAGAGGTGGGGATGGG + Intergenic
1179780068 21:43693957-43693979 GGGTGTGGACAGGTAGGGGTGGG + Exonic
1179792721 21:43764721-43764743 TTGTGGGGACAGGCCGGGCCTGG + Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1180030396 21:45202650-45202672 GTGTGGGGACAGGGAGGCCAGGG - Intronic
1180056624 21:45362282-45362304 GTCTGGGGACAGGTGGGGTGTGG - Intergenic
1180654975 22:17412753-17412775 GTGTGGAGACAGGTGGCGGGCGG + Intronic
1180857788 22:19059229-19059251 GTGTGAGGAGCGGTGGGGCTGGG + Intronic
1181038972 22:20183019-20183041 GTGTGGGGCCAGGGGAGGCCAGG - Intergenic
1181041789 22:20195732-20195754 ATGTGGGGGCAGGTGCGGGTGGG + Intergenic
1181055926 22:20260473-20260495 GCGTGGAGGCAGGTGGGGCCAGG + Intronic
1181366191 22:22378732-22378754 GTGTGGGGTCAGGTGTGGTAAGG + Intergenic
1181950721 22:26551658-26551680 GGGTGGGGACTGATGAGGCTGGG + Intronic
1182073150 22:27477317-27477339 ATGTGGGGACAGCCTGGGCTAGG - Intergenic
1182084961 22:27555180-27555202 GTGGGGGGACTGGTGAGGCAAGG - Intergenic
1182320100 22:29473231-29473253 GTGTGGGGACATGGAGGACTCGG - Intergenic
1182510131 22:30813751-30813773 GTGTGGGGACAGCTGGTGCTGGG + Intronic
1182893956 22:33843622-33843644 TTGTGGGTACAGGGAGGGCTTGG - Intronic
1183041104 22:35178626-35178648 GGGTGGGGAGATGTGGTGCTTGG - Intergenic
1183358758 22:37372712-37372734 GTGTGGGGTCTGGGGGGTCTGGG - Exonic
1183362374 22:37389440-37389462 GGATGGGGACAGGTGGGAATGGG - Intronic
1183387257 22:37522015-37522037 TTGTGGGGGCATGTGTGGCTTGG - Intergenic
1183400637 22:37601900-37601922 GTTAGGGGACAGAAGGGGCTGGG - Intergenic
1183691599 22:39392765-39392787 GTGTGGGGACAGTGGGGGCCAGG - Intergenic
1183707149 22:39481118-39481140 GTGAGGGGACATGGGGGGCAGGG - Intronic
1183777863 22:39979367-39979389 GTGTGGGGACAGGGGGTATTTGG + Intergenic
1184286048 22:43472057-43472079 CGGTAGGGACAGGTGGGGATTGG + Intronic
1184391878 22:44207493-44207515 TTGTGGGGAGGGGTGAGGCTGGG + Exonic
1184489320 22:44799978-44800000 GGGTGGGGCAAGGTGGGGTTGGG + Intronic
1184694757 22:46133149-46133171 CTGTGGGGGCTGCTGGGGCTGGG + Intergenic
1184717947 22:46292613-46292635 GTTTGGGGAGAGGTGAGGATGGG - Intronic
1184759838 22:46537842-46537864 GGGCCGGGAAAGGTGGGGCTGGG + Intergenic
1184981052 22:48096327-48096349 GTGTAGGTACAGGTGGGATTGGG + Intergenic
1185382268 22:50515185-50515207 GCGTGGGGACAGCTGGGGGTCGG + Intronic
952435603 3:33269793-33269815 TTGTGTGGACAGGTGGGGAAGGG - Intergenic
953069580 3:39505950-39505972 GTGTGGGGGCTGGTGGAGCCAGG - Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953413182 3:42701572-42701594 ATGTGGGGCCAGGCGGGGCCAGG + Intronic
954380355 3:50215872-50215894 GGGTGGGGTGGGGTGGGGCTGGG + Intronic
954427340 3:50450318-50450340 GTGCGGGGGTAGGTGGGGCTTGG - Intronic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954631686 3:52051177-52051199 ATGGGTGGGCAGGTGGGGCTGGG + Intronic
954675901 3:52315263-52315285 GGCTGGGGACAGGTGGGGAGCGG + Intergenic
956192616 3:66621959-66621981 GAGTTGGGAGAGGTGGGGTTGGG + Intergenic
956411338 3:68983070-68983092 GTGTGTTCACAGGTGGGGCCTGG - Intronic
956507591 3:69959131-69959153 TTGGGGGAACAGGTGGTGCTTGG - Intronic
956696277 3:71921814-71921836 GTGTTGGGACAGGTGACTCTTGG - Intergenic
957275274 3:78083094-78083116 GTGGGGTGAGAAGTGGGGCTTGG - Intergenic
960575345 3:119223606-119223628 GTATGGGGAGAGGTGGGGGAGGG - Intronic
960951975 3:123005189-123005211 GGGTGGGGACAGGTGGAGGAAGG - Intronic
961168280 3:124778638-124778660 GTGTGGGGACAGGCGGAGATGGG + Intronic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
961635291 3:128329403-128329425 GGGTGGGGGGGGGTGGGGCTGGG - Intronic
961747608 3:129075289-129075311 TTGTGGGGGCAGGGGGGACTTGG - Intergenic
961749704 3:129087974-129087996 GAGTGGGAACAGGTGGGGTCAGG - Exonic
963073033 3:141320632-141320654 GTGTGGGGCCAGGAGGGATTTGG + Intergenic
963958854 3:151285649-151285671 TTGGGGGAACAGGTGGTGCTTGG - Intronic
964629487 3:158794694-158794716 TGGTGGGGAGAGGTGGGGGTGGG + Intronic
965530914 3:169769246-169769268 GGGTGGGGTAGGGTGGGGCTGGG - Intronic
965544357 3:169900126-169900148 GTGTGGGGAAGGGTGGGGAGAGG + Intergenic
965640748 3:170826342-170826364 GTGTGGGGTTAGTTTGGGCTAGG - Intronic
966855336 3:184189758-184189780 GTGTGGGGCCTGGCAGGGCTGGG + Intronic
966897406 3:184456256-184456278 GTGTGGGGACATCTGGCGCCTGG + Intronic
968088730 3:195886498-195886520 GTGTGGGGAGAGGTGGGGACAGG + Intronic
968486730 4:866535-866557 CTGTGGGGACAGGCGGGCATGGG + Intronic
968566652 4:1316923-1316945 GTGTGGGGCCGGGTGGGCCTGGG - Intronic
968567835 4:1323837-1323859 CTGTGGGGACAGGCAGGGCCAGG + Intronic
968573484 4:1354340-1354362 GGGTGGGGGCTGGTGAGGCTGGG + Intronic
968647853 4:1749120-1749142 GTGGGGGGACAGGTGGGGAGGGG - Intergenic
968658135 4:1787353-1787375 GGGTGGGGCCGGGTGGGGCAGGG + Intergenic
968705607 4:2076061-2076083 GGCTGGGGAAGGGTGGGGCTTGG - Intronic
968887431 4:3341870-3341892 GTGTGGGGTGGTGTGGGGCTGGG + Intronic
968956493 4:3722292-3722314 GTGGAGGGTCAGGTGGGGCCGGG + Intergenic
969493219 4:7511665-7511687 GGCTGGGGACAGGTGGGGACAGG + Intronic
969506850 4:7593516-7593538 GTGTGGGGACAGGGGAGGAAGGG - Intronic
969584645 4:8084777-8084799 GTGTGGGGCCAGCAGGGGCGTGG - Intronic
969680293 4:8639628-8639650 GGGAGGGGAGAGGTGGGCCTCGG + Intergenic
969901814 4:10356980-10357002 ATGGGGGTACAGGTGGTGCTTGG + Intergenic
970559436 4:17268367-17268389 GTGTGGGTTCAGGTAGAGCTGGG + Intergenic
971281716 4:25246981-25247003 GTGGAGGGACAGGTGCGGGTGGG - Intronic
971298571 4:25423464-25423486 CTGTGGGGACAGGTGCTGGTGGG + Intergenic
975544934 4:75550707-75550729 GTGTGGGGACAGCAGAGACTGGG - Intergenic
976268238 4:83205316-83205338 GTGAGGGGGCAGTTGGGGGTAGG - Intergenic
977140725 4:93368548-93368570 TTGTGGGGAGAGGTGGGAGTGGG - Intronic
977239209 4:94546311-94546333 GTGTGGGGCCGGGTGGGGTAAGG - Intronic
978751872 4:112258966-112258988 GTTTGGGGAGAGGTGGAGCATGG + Intronic
981925075 4:150130430-150130452 GTGTGGGTACGGGTGTGGCTGGG - Intronic
982208900 4:153019265-153019287 GTGTGGGTGGGGGTGGGGCTGGG + Intergenic
983585832 4:169353600-169353622 GTATGGAGAAAGGTGGGGGTAGG - Intergenic
983760363 4:171397803-171397825 GCCTGGGGACATGTGGAGCTAGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985054481 4:186024344-186024366 TTGAGAGGACAGGTGGGGCGTGG + Intergenic
985508099 5:296289-296311 GTGTGGGGCCAGGCTGGGGTGGG - Intronic
985516063 5:345252-345274 GTGTGGGGAGAGGGGTGGGTGGG + Intronic
985542130 5:492156-492178 GTGTGGGGACTCGTGGGGGAGGG + Intronic
985591103 5:766013-766035 GTGTGGGGACAAAGGGGCCTGGG - Intronic
985644454 5:1078419-1078441 GGGTGTGGACGGGTGAGGCTTGG - Intronic
985739937 5:1609380-1609402 GTGTGGGGCCAGGCTGGGGTGGG + Intergenic
985746535 5:1651711-1651733 GGCTGGGGAGGGGTGGGGCTGGG + Intergenic
985746617 5:1651902-1651924 GTCTGGGGAGGGGTGGGGCTGGG + Intergenic
986831620 5:11585844-11585866 GTGAGGAGAAAGGAGGGGCTAGG + Intronic
988323967 5:29737970-29737992 GTGTTGGTACAGAGGGGGCTGGG - Intergenic
988500405 5:31779159-31779181 GTGTGTGCAGTGGTGGGGCTGGG - Intronic
988850702 5:35177462-35177484 GGCTGGGGAGAGGTGGGGATGGG - Intronic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
990625524 5:57605923-57605945 GTATGGGGACTTGTGGTGCTGGG + Intergenic
990764385 5:59166016-59166038 GTGGGGCGACAGGTGGTGGTGGG - Intronic
994595247 5:101824443-101824465 GGGGGGGGACAGGTGGTGTTTGG + Intergenic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
996405439 5:123098831-123098853 GGGCGGGGACAGGTGGGGCGGGG - Intronic
997246144 5:132351253-132351275 GTGTGGGTACAGATGGAGTTAGG - Intergenic
997472855 5:134126316-134126338 GTGTGGGGACAGATGAACCTGGG + Intronic
998206112 5:140157759-140157781 GTGTGGGGGCAGGCCGGGCGCGG + Intergenic
998393939 5:141806224-141806246 GTGTAGGGACCGGTGGGTCCTGG - Intergenic
998562202 5:143182102-143182124 GTGTGGGGACAGAAGGGTCAGGG - Intronic
998897537 5:146815709-146815731 GTGTGTGGAAAAGTGGGGATAGG - Intronic
999330819 5:150672269-150672291 GGGTGGGGCGAGGTGGGGTTGGG + Intronic
999651656 5:153774061-153774083 GTGTGGGGGGAGGGGGGGTTGGG - Intronic
999912982 5:156226091-156226113 CTGGGGGGACAGGTGGTGTTTGG + Intronic
1000218953 5:159193019-159193041 GTGTGGGGGCTGGTGGTACTAGG + Intronic
1000687130 5:164264836-164264858 GTGGGGGGAAAGGTGGGGGAAGG + Intergenic
1001317834 5:170656889-170656911 GCATGGGGACGGGTGGGGATGGG - Intronic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002313637 5:178329575-178329597 TTGAGGGGACAGGTGTGACTCGG - Intronic
1002696977 5:181098317-181098339 GGGTGGGGAGGGGTGGGGCGGGG + Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1002932455 6:1643997-1644019 GTCTGGGGACAACGGGGGCTGGG - Intronic
1003447710 6:6200032-6200054 GTGTTGGGACTGGTGGTGATGGG + Intronic
1003491561 6:6627007-6627029 AGGTGGGGACAGGTGGGGGAAGG - Intronic
1003590339 6:7431911-7431933 TTGTGGGCTCAGGTGGAGCTGGG + Intergenic
1005719074 6:28583054-28583076 GTGTGAGGAAAGGGGGGGCAAGG + Intronic
1005959315 6:30684692-30684714 GTTGGGGGGCAGTTGGGGCTGGG + Exonic
1006094527 6:31647616-31647638 GTGTTGGGCCCGCTGGGGCTGGG + Exonic
1006097552 6:31665563-31665585 ATGAGGGGAGAGGTGCGGCTTGG - Intronic
1006151754 6:31993623-31993645 GTGAGGGGCTGGGTGGGGCTAGG + Intronic
1006158055 6:32026361-32026383 GTGAGGGGCTGGGTGGGGCTAGG + Intronic
1006804556 6:36779695-36779717 GTGTTGGGTCAGCTGGGGCAGGG - Intronic
1006900818 6:37499799-37499821 GTGAGGGGAAAAGTGGGGGTTGG - Intronic
1007182675 6:39941656-39941678 GTGGGAGAACAGGAGGGGCTTGG + Intergenic
1007341547 6:41194131-41194153 GGGTGGGGACAGGAGGGACAGGG - Intronic
1007485184 6:42175970-42175992 TTGCGGGGAAAGGTGGGACTAGG - Intronic
1007526092 6:42494835-42494857 TTGAGGGAACAGGTGGGGTTTGG + Intergenic
1007615844 6:43179504-43179526 GTGTGTGGGGAGGTGGGGCACGG - Exonic
1007804878 6:44435076-44435098 ATGTGGGGGCAGGGGGGGCGGGG - Intronic
1010028173 6:71243987-71244009 TTGGGGGGACAGGTGGTGTTTGG - Intergenic
1010150613 6:72727738-72727760 GGGTGGGGTCAGCTGGGGTTTGG + Intronic
1011443022 6:87407934-87407956 GGGCGGGGCCAGGTGGGGGTGGG - Intergenic
1013290042 6:108712037-108712059 GTGTGGGGCAGGGTGGGGGTGGG + Intergenic
1013759788 6:113503910-113503932 GTGTGGGGACAGGGGTGTGTAGG + Intergenic
1015110347 6:129585844-129585866 GTGTGGGCACAGGTTGGAATTGG - Intronic
1016827832 6:148404724-148404746 GAGAGGGGAACGGTGGGGCTGGG - Intronic
1016893603 6:149031993-149032015 GAGTGAGGAGAGCTGGGGCTTGG + Intronic
1018631732 6:165827343-165827365 GTGCGGGGACAGGAGGTGCCCGG + Intronic
1018840618 6:167514136-167514158 GGGTGGGGGGTGGTGGGGCTGGG + Intergenic
1018910230 6:168097468-168097490 CTGACGGGACAGGTGGGGCCAGG + Intergenic
1019377131 7:698889-698911 GCGTGGGGAGAGGTGGGGTGGGG - Intronic
1019485230 7:1286159-1286181 GGGTGGGGGCAGGTGAGGCGGGG + Intergenic
1019495967 7:1340870-1340892 GTGATGGGACAGGTGGGTCCTGG - Intergenic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1019621317 7:1993822-1993844 GAGTGGGGACAGGTGGGAGGAGG - Intronic
1019686462 7:2384661-2384683 GTGGGGGACCAGGTGAGGCTGGG + Intergenic
1020431262 7:8118758-8118780 CTCTGGGGACAGGTGGGTCTTGG - Intronic
1020771746 7:12403958-12403980 CTATGGGGACAGGTTGGGCGTGG - Intergenic
1021960786 7:25871137-25871159 CTGTGGGGACATGAGGGCCTGGG + Intergenic
1022207908 7:28180653-28180675 GGGTGAGGAGAGGAGGGGCTGGG + Exonic
1022461493 7:30612596-30612618 GGGTGGGGTCGGGTGGGGGTAGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023255826 7:38311440-38311462 GTGTGGGGGCAGGTGGGCAGAGG - Intergenic
1026077548 7:67186269-67186291 GAGGGGGGAGAGGTGGGGCGGGG - Intronic
1026458188 7:70591154-70591176 GGGTGGGGGCAGGTGGGGTGGGG - Intronic
1026539466 7:71267843-71267865 GGGTGGGGGCAGGTGGGGGGAGG - Intronic
1026584067 7:71642036-71642058 GTGGGGGGACAGCTGATGCTGGG - Intronic
1026699317 7:72625878-72625900 GAGGGGGGAGAGGTGGGGCGGGG + Intronic
1026828470 7:73597605-73597627 GTGGGGGTACAGGAGGGGGTGGG + Exonic
1027235777 7:76297043-76297065 TTTTGGGGACAGATAGGGCTGGG - Intergenic
1027450984 7:78331210-78331232 GAGTGGGGACAGTCGGGGCAAGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1028774495 7:94662139-94662161 GTGTGTGGGGAGGTGGGGGTAGG - Intronic
1029128652 7:98313128-98313150 GTGGGGTGACAGTTGGGGGTGGG - Intronic
1029440542 7:100584606-100584628 GTGTGGGGTTAGGTGGGGGTGGG + Intronic
1029642892 7:101832266-101832288 GTGATGGGAGAGATGGGGCTGGG + Intronic
1031007827 7:116494817-116494839 GTGGGGGGACAGTTGGAGGTGGG + Intronic
1031076575 7:117219209-117219231 GTGTGGTGAAAGGTGGGGATTGG + Intronic
1031923569 7:127618645-127618667 CTCTGGGGACAGCTGGTGCTAGG - Intergenic
1032000344 7:128261098-128261120 CTCTGGGGAGAGGTGGGGATGGG - Intergenic
1032803033 7:135331706-135331728 GACTGAGGACAGGTGGGTCTTGG - Intergenic
1033322453 7:140352218-140352240 GTGTGGGGGAAGGTGGGGGTGGG + Intronic
1033523256 7:142183362-142183384 GTCTGGGGAAAGGTAAGGCTTGG + Intronic
1033657612 7:143383527-143383549 GTGTGGGGCTGGGTGGGGCCTGG + Intronic
1034423173 7:150999678-150999700 GTGTGGGGGTAGGTGGGTGTGGG + Intronic
1034431253 7:151042274-151042296 GTGTGGGGACAGGGGAGTCCAGG + Intronic
1034436053 7:151063205-151063227 GTGGGGTGAGGGGTGGGGCTAGG + Intronic
1034938047 7:155212339-155212361 GTGTGGGGAGGTGGGGGGCTTGG + Intergenic
1034945521 7:155259415-155259437 GGGTGAGGACAGATGGGGATGGG + Intergenic
1034994928 7:155571313-155571335 GGGTGGGGACAGGACGGGGTGGG - Intergenic
1035290710 7:157837018-157837040 GTGGGTGGACAGGTGGTGGTGGG - Intronic
1035316692 7:158001136-158001158 GTGGGGTGCAAGGTGGGGCTGGG + Intronic
1035374488 7:158398414-158398436 GTGGGAAGCCAGGTGGGGCTCGG + Intronic
1035726036 8:1824955-1824977 GCGAGGGGACAGGTGGGGTGCGG - Intronic
1035726099 8:1825129-1825151 GCGGGGGGACAGGTGGGGTGCGG - Intronic
1035726108 8:1825148-1825170 GCGGGGGGACAGGTGGGGTGCGG - Intronic
1035726124 8:1825186-1825208 GCGGGGGGACAGGTGGGGTGCGG - Intronic
1035726133 8:1825205-1825227 GCGGGGGGACAGGTGGGGTGCGG - Intronic
1035726179 8:1825318-1825340 GTGCGAGGACAGGTGGGGTGCGG - Intronic
1036585711 8:10121486-10121508 TTGTGGGGGCAGGTGTGGCAGGG + Intronic
1037711071 8:21355883-21355905 GGGTGGGGGCAGGTGGGACCTGG - Intergenic
1037731032 8:21524207-21524229 ATGTGGGGATTGATGGGGCTTGG - Intergenic
1037806392 8:22059975-22059997 GTGGTGGGTGAGGTGGGGCTGGG + Intronic
1037829130 8:22177807-22177829 GTGGGGGGAGAGGAGGGGGTGGG - Intronic
1038165373 8:25080694-25080716 AGGTGGGGCCAGGTGGGGCAGGG + Intergenic
1038670316 8:29577813-29577835 GTGTGGGCACAGATGGGGGTGGG - Intergenic
1038780993 8:30568432-30568454 ACGTGGGGACAGATGGGCCTGGG - Intronic
1039392478 8:37192648-37192670 ATGTGGGGACTGGTGTGGTTTGG + Intergenic
1041107816 8:54458978-54459000 AGGTGGGGCCAGGTGGGGCCTGG + Intronic
1041247370 8:55901601-55901623 CTGTGGGGTCAGGTAGGGCCGGG + Intronic
1041365695 8:57101617-57101639 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1041693682 8:60714365-60714387 TTGTCAGGCCAGGTGGGGCTCGG - Intronic
1042483897 8:69331253-69331275 GTGTGGGGTCAGGCTGGGGTGGG - Intergenic
1046475438 8:114736473-114736495 TTGTGGGAACAGGTGGTGTTTGG - Intergenic
1046520407 8:115318482-115318504 GTGTGGGGCCAGGTTGGGGGTGG - Intergenic
1047171447 8:122497111-122497133 CTGTGGGGAAGGTTGGGGCTGGG - Intergenic
1048976815 8:139677807-139677829 CTGTGGGGACCTGTTGGGCTGGG - Intronic
1049250056 8:141583453-141583475 GTGTCGGGAAGGGTGGGCCTGGG + Intergenic
1049400361 8:142423974-142423996 GGGTGGGTCCAGGAGGGGCTGGG + Intergenic
1049421264 8:142517639-142517661 GTGGAGGGACAGGTGGGTGTGGG + Intronic
1049432620 8:142572278-142572300 GTGTGGGGCCAGGAGGGGCTTGG - Intergenic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049529586 8:143147727-143147749 GTGTGGGGACAGGGGAGGGAAGG + Intergenic
1049579842 8:143406344-143406366 CTGTGGGTAGAGGTGGGGGTGGG - Intergenic
1049662025 8:143823785-143823807 GAGTGGGTGCAGGTGGGTCTTGG - Intronic
1049729068 8:144166689-144166711 CTGTGAGTACAAGTGGGGCTGGG + Intronic
1049745387 8:144261047-144261069 GGGTGGGGCCAGGCGGGGCGTGG + Intronic
1049797671 8:144504023-144504045 GTGAGGTGGCAGGCGGGGCTTGG - Intronic
1049958989 9:720436-720458 GTGTGAGGACAGCTTGAGCTTGG - Intronic
1049963091 9:755093-755115 CTGTGGGGAAGGGTGGAGCTAGG + Intergenic
1051403123 9:16705144-16705166 GTGTGGCGGCCGGTGGGGGTGGG - Intronic
1051423990 9:16915864-16915886 GTGTGGGGGCCCGGGGGGCTGGG + Intergenic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1055945951 9:81690635-81690657 GTGTTGGGAGAGGTGGGGAGCGG + Intergenic
1056781584 9:89554965-89554987 ATGTGGGGACAGATGGGGTCCGG - Intergenic
1056802386 9:89701594-89701616 GTGAGGGACCATGTGGGGCTGGG + Intergenic
1057197529 9:93123191-93123213 GTGTGGGGAGGGGTGAGGCCAGG + Intronic
1057275942 9:93675971-93675993 GTGTGGGGTCCGGGGGAGCTAGG + Intronic
1057353969 9:94320493-94320515 GGGTGGTGGCAGGTGGGCCTTGG + Exonic
1057653796 9:96937142-96937164 GGGTGGTGGCAGGTGGGCCTTGG - Exonic
1057829397 9:98395398-98395420 CTGAGGGGAGAGGTGTGGCTGGG + Intronic
1057869564 9:98708163-98708185 GTGTGGGGAGGGGTGGGGGTGGG - Intronic
1058818118 9:108704356-108704378 GGGTGGGGGTAGGTGGGACTTGG - Intergenic
1060103072 9:120857056-120857078 GTGTGGTGTCTGGTGGGTCTGGG + Exonic
1060299673 9:122367950-122367972 AGGTGGGGCCGGGTGGGGCTGGG + Intergenic
1060534133 9:124369763-124369785 GTGTGAGGAAAGGTGGGACAGGG - Intronic
1060543411 9:124446923-124446945 AAGTGGGGACAGGTGGGGACAGG + Intergenic
1060543417 9:124446933-124446955 AGGTGGGGACAGGTGGGGGTGGG + Intergenic
1060551851 9:124489358-124489380 TTGTGGGGAAGGGTGGTGCTTGG - Intronic
1060643949 9:125262105-125262127 GTGTCGGGCGAGGTGGGGGTCGG + Intronic
1060815218 9:126631568-126631590 GGGTGGGGTGAGGTGGGGATAGG + Intronic
1061158099 9:128877287-128877309 GAGGAGGTACAGGTGGGGCTAGG - Intronic
1061225380 9:129278262-129278284 GTGTGGAGAAGGGTGGAGCTGGG - Intergenic
1061294204 9:129667978-129668000 GTGTGGGATCAGGTGGGGTGGGG + Intronic
1061623303 9:131825324-131825346 GGGTGGGGAGAGATGAGGCTGGG - Intergenic
1061868269 9:133506490-133506512 GTGGGGGGGTGGGTGGGGCTGGG + Intergenic
1061898321 9:133660053-133660075 GTGGGGGGTGAGGTGGGGGTGGG - Intergenic
1061908975 9:133712915-133712937 TGGTGGGGACAGGAGAGGCTGGG - Intronic
1062165209 9:135104229-135104251 GTGGGTGGGAAGGTGGGGCTGGG + Intronic
1062179162 9:135181413-135181435 GTGGGAGGACAGGCAGGGCTGGG - Intergenic
1062179378 9:135182787-135182809 GTGGAGGGACAGGTGGGCCGAGG + Intergenic
1062334101 9:136057371-136057393 GGGGAGGGACAGCTGGGGCTGGG + Intronic
1062449970 9:136611117-136611139 GTGGGGGGGCAGGTGCGGCCAGG + Intergenic
1062562786 9:137149247-137149269 GTGTGGGTGCGGGTGGGGGTGGG - Intronic
1062655867 9:137604647-137604669 GTCGGGGGCCAGGTGGGGCGAGG - Intergenic
1185456672 X:314221-314243 GTGTGGGAACGGGAGTGGCTCGG + Intronic
1186446448 X:9634239-9634261 GGCTGGGGACTGGTGGAGCTGGG - Intronic
1186727648 X:12374422-12374444 GTGAGGGGCCTGGCGGGGCTAGG - Intronic
1186759491 X:12708722-12708744 GTGGGGAGGCAGGTAGGGCTGGG - Intronic
1187049983 X:15686305-15686327 CTGTGGGGAGAGGTGGTCCTTGG - Intergenic
1188289379 X:28368900-28368922 GTGGGAGTACAGGTGGGGTTGGG - Intergenic
1189003463 X:36970307-36970329 GGGTGGGAATAGGTGGGGGTAGG - Intergenic
1189129741 X:38485490-38485512 GGGTGGGGAGAGGTGGGGTGGGG + Intronic
1189848598 X:45158008-45158030 CTGGGGGGCCAGGTGGGGCGTGG + Intronic
1189988105 X:46571646-46571668 GTGAGGGGAGAGGTGTGGCTGGG - Intergenic
1190078600 X:47337269-47337291 GGGTGGGGTGAGGTGGGGTTGGG + Intergenic
1190107311 X:47569716-47569738 GTGTGGGGCCAAGTGGGGACGGG + Intronic
1190108325 X:47574180-47574202 GTGTGGGGCCGGCTGGGCCTGGG + Exonic
1192638529 X:72843136-72843158 GTGTGGGGTGGGGTGGGGGTGGG + Intronic
1192643185 X:72877672-72877694 GTGTGGGGTGGGGTGGGGGTGGG - Intronic
1193082816 X:77422603-77422625 GTGTGGGCAGAGGTGGGGGTGGG - Intergenic
1193635359 X:83943719-83943741 GTGTGGGTGCTGGTGGGGCTTGG + Intergenic
1194232382 X:91340450-91340472 TTGTGGGAACAGGTGGTGTTTGG - Intergenic
1194750965 X:97683399-97683421 GTGTGGGGAGAGGCGGGCCTGGG + Intergenic
1195298561 X:103504183-103504205 GAGTGGGGAGAGGTGGGGCAAGG + Intronic
1197405734 X:126046802-126046824 GTGTAGGCAGAGGTGGGGATTGG + Intergenic
1199428888 X:147736196-147736218 GTGTGTGGGCGGGTGGGGGTTGG - Intergenic
1199600675 X:149539752-149539774 GTGTGGGAGCAGATGGGGCGGGG - Intergenic
1199856918 X:151766843-151766865 CTGTGGTGAGAGGTGAGGCTGGG + Intergenic
1200133357 X:153863185-153863207 CTGTGTGGAGAGGAGGGGCTGGG + Intronic
1202281816 Y:23198450-23198472 GGGTGGGGACGCGTGGGGGTGGG + Intronic
1202284075 Y:23220069-23220091 GGGTGGGGACGCGTGGGGGTGGG - Intronic
1202433488 Y:24812835-24812857 GGGTGGGGACGCGTGGGGGTGGG + Intronic
1202435751 Y:24834455-24834477 GGGTGGGGACGCGTGGGGGTGGG - Intronic