ID: 961552946

View in Genome Browser
Species Human (GRCh38)
Location 3:127679550-127679572
Sequence CTGTCAGAATGGTGGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961552946_961552961 28 Left 961552946 3:127679550-127679572 CCTCTGTCCCACCATTCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 961552961 3:127679601-127679623 CCTCATGGACTGGGAACTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 136
961552946_961552952 -4 Left 961552946 3:127679550-127679572 CCTCTGTCCCACCATTCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 961552952 3:127679569-127679591 ACAGCCCCCGCAGGTAGGCATGG 0: 1
1: 0
2: 0
3: 11
4: 144
961552946_961552959 19 Left 961552946 3:127679550-127679572 CCTCTGTCCCACCATTCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 961552959 3:127679592-127679614 TTATCTATACCTCATGGACTGGG 0: 1
1: 0
2: 2
3: 7
4: 126
961552946_961552958 18 Left 961552946 3:127679550-127679572 CCTCTGTCCCACCATTCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 961552958 3:127679591-127679613 GTTATCTATACCTCATGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 56
961552946_961552957 13 Left 961552946 3:127679550-127679572 CCTCTGTCCCACCATTCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 961552957 3:127679586-127679608 GCATGGTTATCTATACCTCATGG 0: 1
1: 0
2: 0
3: 4
4: 79
961552946_961552951 -9 Left 961552946 3:127679550-127679572 CCTCTGTCCCACCATTCTGACAG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 961552951 3:127679564-127679586 TTCTGACAGCCCCCGCAGGTAGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961552946 Original CRISPR CTGTCAGAATGGTGGGACAG AGG (reversed) Intronic
901424376 1:9172335-9172357 ATGTCAGAATGAGGGGCCAGAGG - Intergenic
902207937 1:14883490-14883512 CTTTGAAAAAGGTGGGACAGAGG - Intronic
905975314 1:42170009-42170031 CTGTGGGAATGGGGGGACTGAGG - Intergenic
909701036 1:78523414-78523436 TAGTCAGTATGTTGGGACAGTGG + Intronic
910252782 1:85215600-85215622 CTCTCTGAATGGTGGAACTGTGG + Intergenic
911060127 1:93740426-93740448 CTGACAGACTGATGGGACTGGGG - Intronic
911959188 1:104278055-104278077 CTGTCAGAAGGGTGGCAGACAGG + Intergenic
915888562 1:159749537-159749559 GTGTTAGCATGGTGGAACAGAGG - Intergenic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916298875 1:163251420-163251442 CTGTTAGAGTGGTGGGATTGGGG - Intronic
916350464 1:163843852-163843874 CTCTAAGGATGGTGGGACAAAGG - Intergenic
919478419 1:198056505-198056527 CTGGCAGAATGCTTGGACAGGGG + Intergenic
920122472 1:203669087-203669109 CTGGAAGAATGGTGGGATGGTGG - Intronic
921943197 1:220864270-220864292 CATTGAGAATGGTTGGACAGTGG - Intergenic
1064575787 10:16745072-16745094 CTGTCAAAAGGGTGGGGCTGGGG + Intronic
1064618464 10:17189432-17189454 CTGTCAGAATGTTGGTACCATGG - Intronic
1064997383 10:21308204-21308226 GTCTCAGAAGGGTGAGACAGTGG + Intergenic
1067542274 10:47164701-47164723 TGGGCAGCATGGTGGGACAGAGG - Intergenic
1070602850 10:77877864-77877886 CTGTCAGGGTGGCGGGGCAGAGG - Intronic
1071038272 10:81274442-81274464 CTGTCACAATGTTTGGAGAGAGG + Intergenic
1074435487 10:113430747-113430769 CTGACAGATTTGTGGGACACTGG - Intergenic
1075953929 10:126506046-126506068 TTATCAGAATTGGGGGACAGGGG + Intronic
1076063975 10:127434080-127434102 TTGGCAGAATGGTGTCACAGGGG - Intronic
1076887143 10:133268059-133268081 CTGGCAGCCTGGTGGAACAGGGG + Exonic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077683810 11:4272153-4272175 CTGTCAGAATGATGGGTGACAGG - Intergenic
1077686232 11:4294611-4294633 CTGTCAGAATGATGGGTGACAGG + Intergenic
1077889243 11:6406787-6406809 CTGTGAGAGTGGTGGGGGAGAGG - Intronic
1079431006 11:20388051-20388073 CTGCCAGAACTGTCGGACAGCGG + Exonic
1080313900 11:30926440-30926462 CTGTCAGAAAGGTGGAAAATGGG + Intronic
1083728684 11:64641894-64641916 ATGGGAGAATGGCGGGACAGTGG + Intronic
1083915421 11:65740154-65740176 CTCTCAGGATTGTGGGATAGAGG - Intergenic
1084171763 11:67404375-67404397 CTGGCGGAATGCTGGGACAGAGG + Intronic
1084398935 11:68932488-68932510 ATGTAAGAAGGGTGAGACAGAGG - Intronic
1084673526 11:70621454-70621476 CTGGCAGTGTGGTGGGGCAGAGG - Intronic
1084673920 11:70623438-70623460 CTGGCTGCATGATGGGACAGAGG - Intronic
1084911592 11:72394194-72394216 CTGCCAGGCTGGTGGGCCAGGGG - Intronic
1085415819 11:76318493-76318515 CTGTGAGGAGGCTGGGACAGTGG + Intergenic
1086080167 11:82895813-82895835 CTGTGACAAAGGTGGGAAAGGGG + Intronic
1086334642 11:85787798-85787820 CTCTAAGAATGGTGGGCTAGAGG + Intronic
1089758800 11:120707789-120707811 CTGTCAGAACTGAGGGTCAGGGG + Intronic
1089855431 11:121539952-121539974 TTGGCAGACTGGTGGGTCAGTGG - Intronic
1089895110 11:121922474-121922496 CTGTGAGAGTGCTGGGGCAGGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091854220 12:3725800-3725822 CAGCCAGGATGGTGGGGCAGGGG + Intronic
1093122403 12:15287560-15287582 TTGTCATAATGGTGGGGAAGAGG + Intronic
1094204104 12:27822438-27822460 CTTTCAGCTTGGTGGAACAGCGG + Intergenic
1097046867 12:56193455-56193477 ATGTAAGAATGGTGAGAGAGAGG - Intergenic
1097396307 12:59079131-59079153 CTGTCAGAAGGCTGGGGAAGAGG + Intergenic
1097405206 12:59180795-59180817 CTGTCAGAATTATTGGACACTGG + Intergenic
1098054599 12:66491456-66491478 CTGTCAGAGTGGTGGGGCTTGGG + Intronic
1098089984 12:66891404-66891426 CTTTCAGAAGGATGGGACAGTGG + Intergenic
1099136894 12:78916841-78916863 CTGTGAGAATGGGGGTACATAGG - Intronic
1101571291 12:105956329-105956351 CTATCAGGAGGGTAGGACAGTGG - Intergenic
1102258250 12:111428541-111428563 CTGCCAGAAGGGTGGGCCCGAGG - Intronic
1103509481 12:121464775-121464797 CATTCAGCAGGGTGGGACAGAGG + Intronic
1106247110 13:27960059-27960081 CTGTCAATATTGTGGAACAGAGG - Intergenic
1106546781 13:30737687-30737709 CTGTGACAATGGAGGGACAGAGG - Intronic
1106673445 13:31932117-31932139 CTGTTAGAGTTGTGGGGCAGGGG - Intergenic
1108013745 13:46051892-46051914 CTGTCAGAAACGGGGGAAAGTGG - Intronic
1109366515 13:61364025-61364047 CATTCAGACTGGTTGGACAGTGG + Intergenic
1109419956 13:62099279-62099301 GACTCAGAATGGTGGGAGAGTGG - Intergenic
1109423334 13:62142288-62142310 AAGTCAGGATGGTGGGACAAGGG - Intergenic
1110066525 13:71113932-71113954 CTTGCAGAATGGTGGAACAAAGG - Intergenic
1112350726 13:98631197-98631219 CTGTCAGACTCGGGGGAAAGTGG - Intergenic
1113013532 13:105799257-105799279 ATGTGAGAATAGTGGCACAGTGG + Intergenic
1113183950 13:107664581-107664603 TTCTCTGAATGATGGGACAGAGG - Intronic
1113307129 13:109090674-109090696 CTGTCAGAATCATGGGAAGGAGG + Intronic
1113777531 13:112956622-112956644 CTTTCAGGCTGCTGGGACAGTGG + Intronic
1117271920 14:54153208-54153230 CAGGCAGAAGGGTGGGAGAGTGG + Intergenic
1118316734 14:64730334-64730356 CTCTCAGCAAGGTAGGACAGAGG - Intronic
1119781803 14:77280767-77280789 GTGTGAAAATGGTGGGAGAGAGG + Intronic
1121712977 14:96052968-96052990 CTGTCAAAATGGTGACTCAGAGG + Intronic
1121923838 14:97909670-97909692 CTGTCAGGGTGGTGGGGCGGGGG - Intergenic
1122563688 14:102635943-102635965 CTGTCAGAAGGGAGGGAGGGAGG - Intronic
1125667286 15:41441269-41441291 CTATAAGAATAGTGGGAGAGAGG - Intronic
1128405250 15:67330571-67330593 CTGGCAGAGTGGTAGGACATAGG + Intronic
1129241513 15:74255086-74255108 CTTTCAGGATGGGGGGAAAGGGG - Intronic
1129457468 15:75683403-75683425 CTGTCTCACTGGTGGGACAGGGG + Intronic
1129545723 15:76392933-76392955 CTGTGAGAATGGTAAGTCAGTGG + Intronic
1129605485 15:77022982-77023004 CTGTCCCAGGGGTGGGACAGAGG + Intronic
1129726325 15:77903542-77903564 CTGTCTCACTGGTGGGGCAGGGG - Intergenic
1129946197 15:79541202-79541224 CTGTTAGAATGGGGAGAAAGGGG + Intergenic
1135109399 16:19678940-19678962 CTGTCAAAAAGGTGGTACAAGGG - Intronic
1136248658 16:28989628-28989650 CTGAGAGCATGGTGGGGCAGCGG - Intronic
1138627812 16:58266453-58266475 CTGTGAGAATGCCAGGACAGTGG - Intronic
1140876493 16:79157746-79157768 ATGTCAGAGTGGAGGGACATGGG + Intronic
1142179270 16:88659437-88659459 CTTTCAGGAAGGTGGGCCAGGGG + Intronic
1143862460 17:9900829-9900851 CTGTTTGAAGGGTTGGACAGGGG - Intronic
1143903581 17:10192768-10192790 CTGACAGAGTGGTGGGCCAAAGG + Intronic
1144255106 17:13459945-13459967 GAGTGAGCATGGTGGGACAGAGG - Intergenic
1144285256 17:13768207-13768229 GTCTCAGAAAGGTGGGATAGTGG + Intergenic
1147015224 17:37486835-37486857 CTGTCAGAATTGGGGAACAGCGG - Intergenic
1148878954 17:50710615-50710637 CTGGCAGAATGGGAGGGCAGTGG + Intergenic
1149000132 17:51748842-51748864 GTGTCAGAAAGGTGGAAAAGAGG - Intronic
1151551530 17:74825144-74825166 CTGTCTGGATGGAGGCACAGGGG - Intronic
1151656291 17:75497718-75497740 CTATGAGAATTGAGGGACAGAGG + Intronic
1152891661 17:82885109-82885131 CTGTCAGACTTGGGGGCCAGTGG + Intronic
1154196844 18:12273126-12273148 TTGTCTGTATGGTGGGACAGGGG + Intronic
1155195786 18:23472608-23472630 CTGTCAGAATGGAAGGGCACAGG - Intronic
1157300844 18:46477953-46477975 CTGGCAGAGAGGTGGGAGAGTGG + Intronic
1162958982 19:14114997-14115019 CTCTTAGAAGGGTGGGGCAGGGG - Intronic
1164729740 19:30494445-30494467 CTGTCTGAAGGGTGCGACAATGG + Intronic
926112780 2:10193460-10193482 TGGGCAGAATGGAGGGACAGTGG - Intronic
926321704 2:11752945-11752967 CTGTCAGGATGAGGTGACAGAGG - Intronic
926944071 2:18168536-18168558 CTCTCGGAGTGGTTGGACAGTGG - Intronic
927001024 2:18794225-18794247 ATCTCAGAATGATGGGACTGGGG + Intergenic
928239916 2:29577429-29577451 CAGTCTGAATGGTGGGAAGGTGG + Intronic
932072611 2:68636147-68636169 TTGTGAGCATGGTGGGCCAGAGG + Intergenic
932094913 2:68839047-68839069 GTGTCAGAATGGTGAGACTGGGG - Intergenic
933514178 2:83279570-83279592 CTGTCAGAATGACAGGAAAGAGG - Intergenic
939197932 2:138996079-138996101 TTGCCAGCATGGTTGGACAGGGG - Intergenic
939991799 2:148882742-148882764 CTGGCAGAATGGGGAGACAGGGG - Intronic
940905420 2:159164957-159164979 CTGTTAAAGTGGTGGGACAGTGG - Intronic
945212261 2:207395677-207395699 CTGGCAGATTGGTGAAACAGAGG + Intergenic
946503772 2:220277303-220277325 CAAGCAGAATGGTGGGAAAGAGG - Intergenic
947496585 2:230642184-230642206 CTCTTAGAATAGTGGGACAGAGG + Intergenic
1169453986 20:5736122-5736144 CTGTGAACATGCTGGGACAGAGG + Intergenic
1172332398 20:34084382-34084404 CTGTGAGAATAGAGGGACAGAGG + Intronic
1173864177 20:46303719-46303741 GTGTCAGATTGGAGGCACAGTGG + Intronic
1174379604 20:50148202-50148224 CTCTCTGAAGGATGGGACAGAGG - Intronic
1174397742 20:50258434-50258456 CCCTCAGAATGATGGGGCAGAGG - Intergenic
1180048444 21:45320507-45320529 CTGGCAGACAGGTGGGCCAGCGG + Intergenic
1180121043 21:45748358-45748380 CTGTGTGAATGGTGTCACAGAGG + Intronic
1181657406 22:24314751-24314773 TTTTCAAAATGGGGGGACAGGGG - Intronic
1184212047 22:43041881-43041903 CTGTCAGGATGATGATACAGGGG + Intronic
950099169 3:10346606-10346628 GGGCCAGAATGGTGGGGCAGAGG - Intronic
950664646 3:14487954-14487976 CTGTGAGGATGGTGGGAGTGTGG - Exonic
951655438 3:25002074-25002096 ATGTCAGATTCTTGGGACAGTGG + Intergenic
953795661 3:45984038-45984060 CTGTCAGAAAAGTGTCACAGCGG + Intronic
954978777 3:54723714-54723736 CACTGAGAATGGTTGGACAGTGG - Intronic
956884500 3:73545603-73545625 AGGTCAGAATGGTTGGACATTGG - Intronic
960147129 3:114215447-114215469 AAGTCAGAATGGTGGAAGAGGGG - Intergenic
961552946 3:127679550-127679572 CTGTCAGAATGGTGGGACAGAGG - Intronic
967870525 3:194225382-194225404 CTGTGAGAAGGCTGGGACTGTGG + Intergenic
968309226 3:197668943-197668965 CTGTTAGAATGGTGGCATTGTGG - Intergenic
969941040 4:10731920-10731942 CTCTCTGAGTGGTGGGGCAGGGG + Intergenic
970884381 4:20970249-20970271 TTCTTAGAATGGTGGGACTGGGG + Intronic
972060231 4:34860473-34860495 GTGTCAGCATGGTGGGATACAGG - Intergenic
972274655 4:37545807-37545829 CTGACAGAATGGAAGAACAGTGG - Intronic
972839830 4:42917610-42917632 CAGTCAGGATGGAGGTACAGAGG + Intronic
978181881 4:105808021-105808043 TTGTTAGAATGATGGGACAGAGG - Intronic
978279257 4:106990216-106990238 CTGTCATAGTGGTGTGACTGAGG - Intronic
978828535 4:113053895-113053917 CTGTCAAAATAGTGGAATAGTGG - Intronic
980387759 4:132108631-132108653 AAAGCAGAATGGTGGGACAGAGG + Intergenic
982656754 4:158159626-158159648 CTGTCACAGTGGTGAGAAAGCGG + Intronic
984586089 4:181566527-181566549 CTCTGAGAAGGGTGGGAAAGAGG - Intergenic
986263196 5:6167106-6167128 CTGTCAGCATCATGGGACTGAGG - Intergenic
986943153 5:12981318-12981340 CTGTCATAGTGGGGTGACAGGGG + Intergenic
988996739 5:36722234-36722256 CTGAGAGAATGGTGGGACCAGGG - Intergenic
989196608 5:38722800-38722822 CTATTAGGATGGTGGAACAGAGG + Intergenic
991011153 5:61884268-61884290 CTGGCAGAAAGGGAGGACAGAGG - Intergenic
992776103 5:80090606-80090628 CTGCCAGAATGGGAGGACTGGGG + Intergenic
995286198 5:110391021-110391043 CTGTCACAATGATGCCACAGTGG + Intronic
998754214 5:145358379-145358401 CTGGCAGCAAGGTGGGACAATGG - Intergenic
998879362 5:146631044-146631066 CTGTCAGTTTGGTTTGACAGAGG + Intronic
999896943 5:156044600-156044622 CTGGGAGAAAGGTGTGACAGTGG + Intronic
1002922870 6:1585579-1585601 GTGTCAGAATGTGGGGAGAGTGG - Intergenic
1005955724 6:30662129-30662151 CTGTCAGAGTGGTTGGACTCTGG - Intronic
1007619008 6:43200305-43200327 CTGTCAAAATGTGGGGAGAGAGG + Intronic
1009197804 6:60708351-60708373 CTGTGAAAATGGCGGGAAAGAGG - Intergenic
1010866212 6:80979361-80979383 CTGTCAGAATTGGGGGACTGAGG - Intergenic
1013642334 6:112097988-112098010 CTGTCACAATTTTGGGAGAGGGG + Intronic
1016979771 6:149843514-149843536 CTGTCAGAAGGAAGTGACAGTGG - Intronic
1022075623 7:26966878-26966900 CTGTAAGGATGGTGGGAGTGGGG + Intronic
1022816529 7:33919510-33919532 CTCTGAGGGTGGTGGGACAGTGG + Intronic
1024120764 7:46236164-46236186 TTTGCAGAATGGAGGGACAGAGG + Intergenic
1035299627 7:157888405-157888427 TTGTCAGAATGGAGCGAAAGCGG - Intronic
1041706606 8:60852984-60853006 CTGCCAGAGTGGTGGGAGTGTGG + Exonic
1041798343 8:61771006-61771028 CTGTAAATATGGTGGTACAGAGG - Intergenic
1045434825 8:102151907-102151929 ATTTCATAATGGTTGGACAGAGG - Intergenic
1047253320 8:123197015-123197037 CTGACAGAATGGTTGGACCAGGG - Intronic
1047310104 8:123684816-123684838 CTGACTGGATGGTGAGACAGAGG + Intronic
1053550243 9:39070530-39070552 CTGAGATAATGGTGGGGCAGAGG + Intergenic
1053614486 9:39749479-39749501 CTGTCAGGTTGCTGGGGCAGAGG - Intergenic
1053814354 9:41890641-41890663 CTGAGATAATGGTGGGGCAGAGG + Intronic
1053872519 9:42507417-42507439 CTGTCAGGTTGTTGGGGCAGAGG - Intergenic
1053900237 9:42788498-42788520 CTGTCAGGTTGTTGGGGCAGAGG + Intergenic
1054239032 9:62592913-62592935 CTGTCAGGTTGCTGGGGCAGAGG + Intergenic
1054261402 9:62869097-62869119 CTGTCAGGTTGTTGGGGCAGAGG - Intergenic
1054553161 9:66627435-66627457 CTGTCAGGTTGCTGGGGCAGAGG + Intergenic
1054616242 9:67296799-67296821 CTGAGATAATGGTGGGGCAGAGG - Intergenic
1054778284 9:69141934-69141956 CTGTACGAATGATGGAACAGAGG + Intronic
1055148155 9:72961336-72961358 GTGTCAGAATGGAAAGACAGAGG + Intronic
1055764498 9:79647841-79647863 GTGTCAGAATTGAGAGACAGTGG + Intronic
1055821266 9:80267344-80267366 GTGTCAGACTGGTGGGCAAGAGG + Intergenic
1056326975 9:85488186-85488208 ATGTCAGAATGGTGGGGCCCTGG + Intergenic
1056503033 9:87229352-87229374 CTCTCAGGCTGGTGGGAAAGCGG + Intergenic
1056512483 9:87319149-87319171 CTGTTAGAATGCTGGTAGAGGGG - Intergenic
1059113783 9:111582566-111582588 ATGTCAGAATGGTTCGACATTGG + Intronic
1062193455 9:135259421-135259443 CTGTCTGCATGGGGTGACAGCGG + Intergenic
1188308754 X:28590442-28590464 GAGTCAGAATGGTGGGATTGGGG + Intronic
1191976075 X:66872975-66872997 GTGTCAGAATGGAGGGACTTGGG + Intergenic
1194249898 X:91561592-91561614 CAGGCACAATGGTGGGTCAGAGG + Intergenic
1194346676 X:92773739-92773761 TTGACGCAATGGTGGGACAGGGG - Intergenic
1195448014 X:104975878-104975900 CTCTCAGAATTGGGGGACCGAGG + Intronic
1195658791 X:107358685-107358707 CTGGAAGACTGGAGGGACAGAGG + Intergenic
1197176917 X:123495810-123495832 CAGACACAATGGTGGGAGAGGGG + Intergenic
1201336725 Y:12889535-12889557 CTGTCAGAGTGTGGGGGCAGGGG - Intergenic
1201440578 Y:14003946-14003968 CTGACAGTAAGGTGGGCCAGAGG - Intergenic
1201443993 Y:14038762-14038784 CTGACAGTAAGGTGGGCCAGAGG + Intergenic