ID: 961554356

View in Genome Browser
Species Human (GRCh38)
Location 3:127688099-127688121
Sequence CCTGCTTCCCAGAGGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 384}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961554356_961554361 -6 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554361 3:127688116-127688138 AGCAGGCAGAGGTGTAGTGCAGG 0: 1
1: 0
2: 2
3: 39
4: 440
961554356_961554364 21 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554364 3:127688143-127688165 TGCCCTTTTGCAGCTCACAAGGG 0: 1
1: 0
2: 1
3: 11
4: 173
961554356_961554363 20 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554363 3:127688142-127688164 ATGCCCTTTTGCAGCTCACAAGG 0: 1
1: 0
2: 2
3: 18
4: 136
961554356_961554362 -5 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554362 3:127688117-127688139 GCAGGCAGAGGTGTAGTGCAGGG 0: 1
1: 1
2: 3
3: 143
4: 574
961554356_961554369 26 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554369 3:127688148-127688170 TTTTGCAGCTCACAAGGGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 164
961554356_961554367 24 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554367 3:127688146-127688168 CCTTTTGCAGCTCACAAGGGAGG 0: 1
1: 0
2: 2
3: 9
4: 97
961554356_961554368 25 Left 961554356 3:127688099-127688121 CCAGGGACCCTCTGGGAAGCAGG 0: 1
1: 0
2: 2
3: 47
4: 384
Right 961554368 3:127688147-127688169 CTTTTGCAGCTCACAAGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961554356 Original CRISPR CCTGCTTCCCAGAGGGTCCC TGG (reversed) Intergenic
900117344 1:1034253-1034275 CCTGCTGCCCACAGCCTCCCCGG - Intronic
900327555 1:2116315-2116337 GCTGCTTCTCCGAGGCTCCCGGG + Intronic
900354481 1:2253706-2253728 GCTGCTGCCCACAGGGGCCCTGG + Intronic
901405114 1:9040107-9040129 CCTTCTTCCCCGAGAGCCCCAGG - Exonic
901838189 1:11937567-11937589 CCTGCATCCCAGACCATCCCAGG + Intronic
902155134 1:14479001-14479023 CATGCTTCCCAGAAGCTCCCAGG - Intergenic
902277333 1:15349409-15349431 CCTGCATCCTAGAGGGCCCTCGG + Intronic
902580034 1:17402404-17402426 CCTGCTGCCCACAGAGCCCCAGG - Intergenic
903326744 1:22573192-22573214 CCTGCTTCCAAAGGGGCCCCAGG - Intronic
903479873 1:23645303-23645325 CCAGCTTCCCAGAGGGGCTTTGG - Intergenic
903809736 1:26028655-26028677 ACTGCTGCCCAGAGGTCCCCTGG - Intronic
904068492 1:27773593-27773615 CCGGGTTGCCCGAGGGTCCCCGG + Intronic
904307408 1:29599082-29599104 CCTGCTGCCCAGGGGTGCCCGGG - Intergenic
904396333 1:30224865-30224887 CCTGCTGCCCAGGGGTGCCCGGG + Intergenic
904489148 1:30847590-30847612 CCTGTTTCCCAGAGGGAATCCGG + Intergenic
904895197 1:33812040-33812062 CCTGCTTCCCAGACCCTCCTAGG - Intronic
905415882 1:37803909-37803931 CCTGCTTCCCAGAGTTTCACAGG + Exonic
905937417 1:41835823-41835845 ACTGCTTCTTAGAGGGGCCCAGG - Intronic
907118057 1:51987036-51987058 ACGACTTCCCAGATGGTCCCTGG - Intronic
908534896 1:65067603-65067625 CCTGCGCCCCCGGGGGTCCCGGG + Intergenic
909483699 1:76151684-76151706 CCTCCTTACCAGAGGTTCTCTGG - Intronic
911051425 1:93674838-93674860 CCTGCTGCTCAGAAGGTCCATGG + Exonic
913331672 1:117672802-117672824 CCTGCTTCTCAGAGGGTACAAGG - Intergenic
915571001 1:156744968-156744990 TCTGCTTTCCAGGGGGTCTCTGG + Intronic
915599598 1:156913933-156913955 CCAGCTTGCCAGGGGGCCCCCGG + Exonic
916056925 1:161074347-161074369 CCTGCTTCCCAGAGTCTTCCTGG + Exonic
916668543 1:166989808-166989830 CCTGCTTCTCTGAGGGCCCAGGG - Exonic
917617962 1:176765672-176765694 CCTGCTTCCCACAGGGCCGATGG - Exonic
919761329 1:201099953-201099975 CCTGCTTTCTTGGGGGTCCCAGG - Intronic
919768816 1:201144225-201144247 CCTGATGCCGAGAGGCTCCCGGG + Intronic
920092616 1:203465073-203465095 CCTCCTCCCCACATGGTCCCTGG - Intergenic
922291528 1:224212801-224212823 CCTGCCTCCCAGAGCGCCCGGGG - Intergenic
922513059 1:226186141-226186163 CCCGCCTCCCAGAGGTTACCGGG - Intronic
922784145 1:228274820-228274842 TCTGCTGCCCTGAGGGTCCGAGG + Exonic
924578700 1:245304007-245304029 CCTGCTTCAACGAGGATCCCAGG + Intronic
1062829727 10:597520-597542 CCTGCTGCCCAGCGTGTCCTCGG - Intronic
1063078810 10:2745067-2745089 TGTCCTTCCAAGAGGGTCCCTGG + Intergenic
1063970526 10:11378495-11378517 CCTGCTTTCCGAAGTGTCCCTGG - Intergenic
1064566272 10:16641922-16641944 CCAGCTTGTCAGAGGGTCCTGGG - Intronic
1064982120 10:21174686-21174708 CCTGCGTCCCAGAGGGGCCGAGG + Intergenic
1066388932 10:34963389-34963411 CCGTCTTGCAAGAGGGTCCCAGG + Intergenic
1068048225 10:51915001-51915023 CCTTTTCCCAAGAGGGTCCCTGG - Intronic
1068620395 10:59176157-59176179 CCTCCTCCCCTGAAGGTCCCAGG - Intergenic
1069568421 10:69479297-69479319 CCTGCTTCCCAGCAGCTGCCTGG + Intronic
1070713398 10:78699972-78699994 GCTGCTCTCCAGAGTGTCCCAGG - Intergenic
1071108569 10:82127653-82127675 CCTTCTTCCCAGTTGGTGCCAGG + Intronic
1072225722 10:93367162-93367184 CCTGCTTCCCAGAGAGGCCTTGG - Intronic
1072916658 10:99540960-99540982 GCTGCTTCCCAGGCGGGCCCGGG + Intergenic
1073603618 10:104871083-104871105 CCTGCTTCCCAGAGGAACCACGG + Intronic
1073865288 10:107796343-107796365 CCTGATTCCTGGAGGGTCCTTGG - Intergenic
1074299687 10:112222617-112222639 CATGCTTCAAAGAGGGACCCTGG - Intergenic
1075242979 10:120794611-120794633 GCTGCTTCCCAGAGGTCCCTAGG - Intergenic
1075738639 10:124679667-124679689 CCTGCTTGGCAGTGGGTCTCGGG - Intronic
1076224342 10:128762029-128762051 GCTGCTTCCCTGAAGGTCCTTGG + Intergenic
1076245262 10:128942400-128942422 CCTGCTTCCTATAGGGTCCTAGG - Intergenic
1076373358 10:129968427-129968449 CCTCCTTCCCACTGGGGCCCAGG - Intergenic
1076731780 10:132442825-132442847 CCTGCCTCCCCGAGGTCCCCGGG + Intergenic
1077220412 11:1413201-1413223 TCTGCCTCCCAGACGGCCCCTGG + Intronic
1077325849 11:1963697-1963719 CCTCCTTCCCACAGGTTCACTGG + Intronic
1077331936 11:1987669-1987691 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1077423921 11:2465694-2465716 CATGCTTCCCAGAGCTTCCTGGG + Intronic
1077442103 11:2573671-2573693 CCGGCTTCCCCAAGGCTCCCGGG - Intronic
1078141166 11:8694010-8694032 ACAGCAGCCCAGAGGGTCCCAGG + Exonic
1078904543 11:15671703-15671725 CCTCCTCCCCAGAAGGTCCCAGG - Intergenic
1080639325 11:34149652-34149674 CCTGCTACCCACAGGCTCCAAGG + Intergenic
1081546561 11:44075996-44076018 CCTGTTTCCAAAATGGTCCCTGG + Intronic
1081577850 11:44330312-44330334 TGTGCTTCCCAGTGGGTCCTGGG - Intergenic
1081687644 11:45053903-45053925 CCTGCTTCCCAGATGCCACCTGG - Intergenic
1082278454 11:50246192-50246214 CCCTCTTCCCTTAGGGTCCCAGG - Intergenic
1083829244 11:65220879-65220901 CCTGTGTCTCAGAGGGTCTCTGG + Intergenic
1084068497 11:66719027-66719049 CCTGTTTCCCAGAGGTTTGCAGG + Intronic
1084657384 11:70527406-70527428 CCCGCTTCCCAGTGGGCCCTGGG + Intronic
1084677480 11:70644475-70644497 TCTGCTTCCCGATGGGTCCCAGG + Intronic
1084961302 11:72718157-72718179 CCTGCTTACCACAGGGTATCAGG + Intronic
1084969493 11:72762877-72762899 CCTGCTACTCAAAAGGTCCCTGG + Intronic
1085039319 11:73317635-73317657 CCTGCTTCCCAGGGGACCCAGGG - Intronic
1085316932 11:75550960-75550982 CCTGCTCCCCAGAGCCTTCCCGG + Intergenic
1087292963 11:96340085-96340107 CCTACTCCCCAGAGATTCCCAGG + Intronic
1089141135 11:116285251-116285273 CCCCCTTCCTACAGGGTCCCAGG + Intergenic
1089642188 11:119855030-119855052 TCTGCTTCCAAGAGGGGCACAGG - Intergenic
1089853245 11:121518241-121518263 CCTTCTTCCCAGAGTGCCCTGGG - Intronic
1090660694 11:128879898-128879920 CCTGCGGCCCTCAGGGTCCCTGG - Intergenic
1091279858 11:134375643-134375665 GCTGCTTCCCACAGGGTGACAGG + Exonic
1202808829 11_KI270721v1_random:18876-18898 CCTCCTTCCCACAGGTTCACTGG + Intergenic
1202814917 11_KI270721v1_random:42845-42867 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1092132353 12:6121320-6121342 CCTTCTGCACAAAGGGTCCCTGG + Exonic
1092950510 12:13499102-13499124 CCTGCTTCCCTGAGGCTTCGGGG + Intergenic
1093904695 12:24676760-24676782 TCTGCTTCCAAGATGGTACCGGG + Intergenic
1094117966 12:26938173-26938195 CCTGCTTCCCAATGGGTGACTGG - Exonic
1094225480 12:28040516-28040538 TCTGCTACCCAGAGGGACCGAGG - Intergenic
1095976508 12:47943870-47943892 CCTGCTTCCCAGAGGGCATGGGG - Intergenic
1097349034 12:58527425-58527447 CCTCCTTACCAGAGTTTCCCTGG + Intergenic
1098039656 12:66341161-66341183 ATTGCTTCCCAGAGGCTCCTGGG - Exonic
1099897626 12:88668224-88668246 GCTTCATCCCAGAGGGTCACCGG - Intergenic
1100979489 12:100153584-100153606 CCTGCTTCCCCCAGGGTCCTGGG + Intergenic
1101575600 12:105993886-105993908 GCTCCTTCCCAGTGGATCCCTGG + Intergenic
1101641381 12:106587520-106587542 CCTGCTTCCCAGAGGCTCCGAGG + Intronic
1101754461 12:107610135-107610157 GCGGCTTCCCAGAGGGGCACAGG - Intronic
1101837295 12:108304382-108304404 TCTGCTGCCCAGATGGTCCCCGG - Intronic
1102009678 12:109610606-109610628 CCAGTGTCTCAGAGGGTCCCTGG - Intergenic
1102200594 12:111055374-111055396 GCTGCTGGCCCGAGGGTCCCAGG - Intronic
1102247009 12:111362313-111362335 CCTGCAGCTCAGAGGGTCACTGG - Exonic
1103584569 12:121942469-121942491 CTGGCTTCCCAGAGAGTCCCAGG - Intronic
1104035012 12:125092033-125092055 CCAGCTGCCCAGAGTGGCCCAGG + Intronic
1104714021 12:131004958-131004980 CCTGCTTGCCCGAGGTCCCCAGG - Intronic
1105404070 13:20119063-20119085 GCTGCTTCCCTGCTGGTCCCGGG - Intergenic
1106642042 13:31594816-31594838 CCTGCTTCTTAGAGTTTCCCTGG + Intergenic
1107165385 13:37277147-37277169 CCTGCTTCCCAGTGGAGCACTGG + Intergenic
1107627077 13:42299398-42299420 GCTGCTTCCCAGACGGTTACTGG + Exonic
1111056154 13:82953384-82953406 GCTGCATCCCAGAGGGGCACTGG - Intergenic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1112562363 13:100525951-100525973 TCCACTTCCCAGAGAGTCCCCGG + Intronic
1113843694 13:113374287-113374309 CCAGCGTCCCAGAAGGTCCAGGG + Intergenic
1114527385 14:23375376-23375398 CCTGCCTCCCTCACGGTCCCAGG + Intronic
1115507234 14:34104153-34104175 GCTGCTTCCCAGGGGGACACAGG + Intronic
1118867291 14:69713407-69713429 CCCACTTCCCAGAGGCTCCTGGG + Exonic
1119323043 14:73742763-73742785 CTTTCTTCTCTGAGGGTCCCAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1119650342 14:76378610-76378632 GCTGCTGCCCAGTGGGTCCTGGG - Intronic
1120355091 14:83422428-83422450 CCTGCTACCAAGAGTTTCCCAGG - Intergenic
1120402981 14:84055658-84055680 TCTGCTTCCAAGATGGTGCCTGG + Intergenic
1120692520 14:87608093-87608115 TCTGCTTCCAAGATGGTGCCTGG - Intergenic
1121413225 14:93762127-93762149 CCTGCATCCCACAGGGTCCCAGG - Intronic
1121432485 14:93897908-93897930 GCTGCTTCCAGGAGGGTCCCTGG + Intergenic
1121617443 14:95322080-95322102 CCTGTTTCCTAGAGTGTCTCTGG + Intergenic
1121711820 14:96044095-96044117 GCTGATCCACAGAGGGTCCCTGG - Intronic
1122013871 14:98776969-98776991 CCTCCTGCCCACAGGGTCCTAGG + Intergenic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122263039 14:100534069-100534091 CCAGCTGCCTAGAGGGTCCCTGG + Intergenic
1122291122 14:100681019-100681041 TCTGTATCCCAGAGGGCCCCCGG + Intergenic
1123203572 14:106691573-106691595 CCTGCTGTCCTGAGTGTCCCTGG + Intergenic
1126142368 15:45448780-45448802 CCTGCAGCCCAGACGCTCCCTGG - Intergenic
1129193494 15:73951280-73951302 CCTGCTGCCCACAGGCCCCCGGG - Intronic
1130014547 15:80176509-80176531 ACAGCTTCCCAGAGGGCCCTGGG - Intronic
1131511146 15:93050182-93050204 CCTCCCTCCCAGAAGCTCCCAGG - Intronic
1133103833 16:3494525-3494547 ACTGCTTCCCAGGCTGTCCCTGG + Exonic
1133388834 16:5392798-5392820 CCTGCTGCCCACAGGGTCAGGGG - Intergenic
1133733652 16:8597256-8597278 TCTGGATCCCAGAGGTTCCCAGG + Intergenic
1133821690 16:9242832-9242854 CCTATTTCCATGAGGGTCCCTGG + Intergenic
1133832503 16:9336745-9336767 CCTTCTTCCCAGCTGATCCCTGG - Intergenic
1134333222 16:13269518-13269540 CCTGCTTGGCAGAGGCTCACTGG - Intergenic
1135004875 16:18811431-18811453 CCTGCAACCCAAAGGGTCCTTGG + Intronic
1135142759 16:19935835-19935857 GCTGCTGCCCAGGGAGTCCCTGG + Intergenic
1135894893 16:26390568-26390590 CCTGGTTCCCAGATTATCCCAGG + Intergenic
1136617535 16:31407780-31407802 CCTGCCTGGCAGTGGGTCCCTGG - Exonic
1137056338 16:35748228-35748250 CCTGCTCCCCTGTGAGTCCCAGG + Intergenic
1137475990 16:48810756-48810778 CCAGCTTCCCCGCGGGTCCGGGG + Intergenic
1137506381 16:49057490-49057512 CCTGCTTCCCATGCAGTCCCAGG - Intergenic
1137585917 16:49664098-49664120 CCTGCTCACCAGGGCGTCCCAGG + Intronic
1138586832 16:57976093-57976115 CCCTCTTCCCTGAGGGTTCCAGG + Intergenic
1139380831 16:66529652-66529674 CTTGCTTCCCAGAGGAACGCTGG - Intronic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1140488269 16:75311970-75311992 CCTGTTTCTCAGAGAGTTCCAGG - Intronic
1140777579 16:78264178-78264200 CCTTCTCCCAAGTGGGTCCCTGG - Intronic
1141638877 16:85329798-85329820 CCTTCTTCCCAGGCAGTCCCTGG - Intergenic
1142249322 16:88983891-88983913 CCAGCCTCCCTGGGGGTCCCAGG + Intergenic
1142397137 16:89838531-89838553 CGTGCTTCCCTGAGCTTCCCTGG - Intronic
1145258785 17:21342540-21342562 CCAGGTTCCCAGAGAGGCCCAGG - Intergenic
1145317839 17:21745464-21745486 CCAGGTTCCCAGAGAGGCCCAGG + Intergenic
1146686565 17:34845228-34845250 CCTTCTTCCCAGAAGGTCCTAGG - Intergenic
1146933152 17:36792340-36792362 CCTGCATCCCAGGGCGTCCCTGG - Intergenic
1147148261 17:38498553-38498575 ACTGCATTCCTGAGGGTCCCAGG + Intronic
1150237950 17:63608218-63608240 CCTGCATCCGAGAGGGTGTCGGG - Exonic
1150724443 17:67640226-67640248 CCTGCTGCCAAAGGGGTCCCTGG + Intronic
1150768362 17:68020406-68020428 CCTGCCCTGCAGAGGGTCCCGGG - Intergenic
1152224326 17:79085737-79085759 GATGCTTCCCAGAGGGGCTCGGG + Intronic
1152230828 17:79113214-79113236 CCTTCCTCCCAGAGGCTGCCCGG - Intronic
1152462867 17:80450444-80450466 CCTGCTTCCAAGAAGGCTCCCGG + Intergenic
1152499400 17:80697931-80697953 CCTGGTGCCCAGTGGGTCACAGG - Intronic
1152845998 17:82600107-82600129 CCTGCTTCTCAGAGCATCACGGG + Intronic
1153329994 18:3863796-3863818 GCTGCTTCCTAGAGGGGCCTGGG - Intronic
1153757151 18:8295547-8295569 CTTCCTTCCCAGTGGGTGCCAGG + Intronic
1154173629 18:12067851-12067873 CGCGCTTCCCAGGGGGTCCCCGG - Intergenic
1156702317 18:39840740-39840762 GCTGCATCCCCGAGGGCCCCAGG - Intergenic
1156822502 18:41389864-41389886 GCTGCCTCCCAGAGAGTCCAGGG - Intergenic
1157097503 18:44699749-44699771 CCTGCTCCCCAGAGAAGCCCAGG - Intronic
1157557241 18:48620931-48620953 CCTGCTTCCCAGTGGGGACAGGG - Intronic
1157818807 18:50750610-50750632 GCAGATACCCAGAGGGTCCCTGG + Intergenic
1160015634 18:75138300-75138322 TCTGCTTCCAAGATGGTACCTGG + Intergenic
1161012981 19:1969069-1969091 CCTCTTTCCCAGAGCGGCCCTGG + Intronic
1161320355 19:3638092-3638114 CCTCCTTCCCAGGGGGTGCAGGG + Intronic
1161493966 19:4577605-4577627 CTTGCCTCCCAGTGGGGCCCTGG + Intergenic
1161495609 19:4584350-4584372 CCTTCTTCCCAGTGCGGCCCGGG + Intergenic
1161500404 19:4611423-4611445 CCTGAATCCCAGAAGGTCTCAGG - Intergenic
1161526606 19:4759946-4759968 CCTGCTTCCCGGCGGGCCCTCGG - Intergenic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161681091 19:5680240-5680262 CCTGCTTCCCAGCGAGCCCTTGG - Intronic
1162017803 19:7855065-7855087 CCTGCTCCCCAGAGTGTCCTGGG + Intronic
1162223421 19:9199137-9199159 ACTGCTTACCAGTGGGTTCCTGG + Intergenic
1162373885 19:10294028-10294050 CCTGTTTCCCAGATGGCCCCAGG + Exonic
1162496481 19:11025980-11026002 CCTGCTGCCCCGAGAGCCCCTGG + Intronic
1162563375 19:11431010-11431032 CCTGCCTGCCAGAGGGTGACCGG - Exonic
1163410458 19:17150662-17150684 CCCTCTTCCCACAGGGGCCCTGG + Intronic
1163634438 19:18431660-18431682 CGCGCTTCCCAGGGGGCCCCCGG + Exonic
1163786780 19:19278894-19278916 CCTCCTTCCCTGGGGGCCCCAGG - Intronic
1164947881 19:32311506-32311528 TCTGCTTTCCAGAGGGTCCTGGG - Intergenic
1165068352 19:33241551-33241573 CCCTCTGCCCAGAGGGCCCCAGG + Intergenic
1167497995 19:49830497-49830519 CCTTCTACCCACAGGTTCCCGGG + Exonic
1167547898 19:50140263-50140285 CCTGCCTCCCTGAGGGCCCGAGG + Intergenic
1168398200 19:56066622-56066644 CCTGCTCCCGGGAGGGTCTCAGG - Intergenic
1168432992 19:56295991-56296013 CCAGCTTCCTACAGAGTCCCGGG - Intronic
925057297 2:865015-865037 CCTGCTTCCCCCTGGGTCCGTGG - Intergenic
925367107 2:3318050-3318072 CCTGCTTCCTGCTGGGTCCCAGG + Intronic
925640475 2:5981775-5981797 CCTGCTTTACCGACGGTCCCGGG - Intergenic
925735324 2:6958692-6958714 TCTATTTCCCAGAGGGTCCCAGG + Intronic
925771943 2:7290510-7290532 CTTCCTTCCTTGAGGGTCCCTGG - Intergenic
926037827 2:9648940-9648962 CCTGCCTCCCAGCTGGTACCTGG + Intergenic
926304766 2:11629882-11629904 CCTGCTTCCCAGAAGACCCCAGG - Intronic
926418473 2:12674253-12674275 CCTGCTTATCAGAGGCTCCTGGG + Intergenic
926626779 2:15097068-15097090 CCTGGTTCCCAGAGTCACCCAGG - Intergenic
927757354 2:25719695-25719717 CCTGCCTCCCAGAGAGGCCTGGG - Intergenic
927852511 2:26509112-26509134 CCAGCTTCCCAGTCTGTCCCAGG - Intronic
928360798 2:30660668-30660690 CCTGCTTTTCAGAGGGTACGGGG + Intergenic
928830630 2:35478355-35478377 CCTTCATCCCAGAGGGGCACTGG - Intergenic
929073304 2:38056150-38056172 CCTGCTCCCCACTGGATCCCGGG - Intronic
931417084 2:62091572-62091594 AATGCTTCCCAGAGGCGCCCTGG + Intronic
931668297 2:64625550-64625572 CCTCCATCCCAAAGGGTCCTGGG + Intergenic
931791512 2:65667751-65667773 CCTCCTCCCCAAAGGGTCCCCGG - Intergenic
931868284 2:66434249-66434271 CCTCCCTCCCAGCGGCTCCCCGG + Intronic
932438848 2:71719108-71719130 CCTACTTCCCAGCTGGCCCCAGG + Intergenic
932582016 2:72998327-72998349 CCTGCTTCCCAGAGGAGGCCAGG - Intronic
934079250 2:88452872-88452894 CCGGCCTCCCAGACGCTCCCGGG - Intergenic
934709018 2:96503233-96503255 CCTGCTTCTCAAGGGCTCCCAGG - Intronic
936048482 2:109204649-109204671 CCTGCCTGCCAGCAGGTCCCTGG - Intronic
936153536 2:110034193-110034215 AGTGTTTCCCAGAGGGTTCCTGG - Intergenic
936191145 2:110337222-110337244 AGTGTTTCCCAGAGGGTTCCTGG + Intergenic
936268457 2:111029706-111029728 CCTGCTGGCAAGAGGCTCCCTGG - Intronic
936520185 2:113207043-113207065 CATGCTTCCAAGATGGCCCCAGG + Intronic
937252954 2:120535535-120535557 ACTGCTTCCCAGTGGAGCCCTGG + Intergenic
937953650 2:127407382-127407404 CCTGCTGGCCAGAGGCTTCCTGG - Intergenic
938083829 2:128385259-128385281 CGTGGTTTCCAGAGGGTCTCAGG - Intergenic
938701375 2:133883164-133883186 GTTGCTTCTCAGAGGGTCCAAGG - Intergenic
938935868 2:136126972-136126994 CCTGCTTTCTAGCAGGTCCCAGG + Intergenic
939673593 2:145043787-145043809 ACGGTTTCTCAGAGGGTCCCCGG + Intergenic
942246528 2:174013294-174013316 CCCCCTTCCCTGAGGGTCGCCGG - Intergenic
943667840 2:190628793-190628815 CCGGCTTCCCAGAAGCTTCCTGG + Intergenic
944605441 2:201347869-201347891 CCTGCTCCCCTGAGGGGTCCCGG + Intronic
944951213 2:204751392-204751414 TCTCCTGCCCAGAGGGCCCCAGG - Intronic
945482123 2:210357065-210357087 GCTTCTTCCCAGAGGGTCACTGG + Intergenic
945718953 2:213394539-213394561 TCTGCCTGCCAGAGGATCCCTGG + Intronic
946196639 2:218036060-218036082 CCAGCATCACAGAGGTTCCCAGG - Intronic
948455188 2:238101535-238101557 CCCGCTGGCCACAGGGTCCCGGG - Intronic
948567970 2:238898447-238898469 CTTGCTACCCAGTTGGTCCCTGG - Intronic
948904238 2:240970693-240970715 CCTGCTCCCCAGGGGGGCTCTGG + Intronic
1170407262 20:16051120-16051142 CCTACTTCCCACAGCCTCCCCGG + Exonic
1171245401 20:23606443-23606465 TCTGCTCCCCCGAGGGTCTCGGG + Intergenic
1171362720 20:24600424-24600446 CCTTCTACCCTGGGGGTCCCAGG - Intronic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1172442502 20:34976149-34976171 CCTGCCTCCCAGAGGCTCTCTGG + Intronic
1172442633 20:34976944-34976966 CCTGCCTCCCAGAGGCTCTCTGG - Intronic
1172692577 20:36800373-36800395 CCTGCTTTCCACATGGTACCTGG + Intronic
1174137996 20:48393647-48393669 CCAGCTTCCAGGAGGGTCACGGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176233780 20:64044935-64044957 CCTTCTTCCCTGAGGCTCCAAGG - Intronic
1176656362 21:9591807-9591829 CCTCCTTCAGAGAGGCTCCCTGG - Intergenic
1177232470 21:18340359-18340381 CCTGGTTGCCAGAGGCTCTCAGG + Intronic
1178263822 21:31124341-31124363 CCTCCTTCCCAGTGGCTCCTGGG - Intronic
1179465379 21:41568230-41568252 CCTGCTGCCCAGACAGTGCCTGG - Intergenic
1179501741 21:41813459-41813481 CCTGCTCCCCAGAGTGGCGCGGG - Intronic
1179546605 21:42116454-42116476 CCTGACTCCCTGAGTGTCCCTGG + Intronic
1179658935 21:42862574-42862596 CTCCCTCCCCAGAGGGTCCCTGG + Intronic
1180251704 21:46594502-46594524 CCTGCTGTTCAGCGGGTCCCAGG - Intergenic
1180947673 22:19705553-19705575 CCTGGCTCCCAGGGGCTCCCAGG + Intergenic
1180985227 22:19900232-19900254 CCTGCTTGGCTGGGGGTCCCAGG - Intronic
1181000415 22:19985429-19985451 CCTGCTCACAAGAGGGTCCCGGG + Intronic
1181269802 22:21652419-21652441 CCTGCTCCAAAGAGGGCCCCCGG - Intronic
1181370375 22:22410393-22410415 GCTGCTTCCCTCATGGTCCCAGG + Intergenic
1181610608 22:24009004-24009026 CCTGCTTCCCAGAGTGCCTCAGG + Intergenic
1181624597 22:24114663-24114685 ACTGCCTCCCTGAGGGACCCAGG + Intronic
1181631514 22:24154079-24154101 CCTGCATCCCAGAGGCCTCCAGG - Intronic
1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG + Intronic
1183407337 22:37636823-37636845 CATGCTACCCAGACTGTCCCAGG + Intronic
1183648561 22:39140776-39140798 CCAGCTTCCCTGAGGGGCCCTGG + Intronic
1183785443 22:40026633-40026655 CTTGCTTCCCAGAGTGCCTCGGG + Intronic
1184642134 22:45878367-45878389 CCTGCTCCGGAGTGGGTCCCAGG + Intergenic
1184647282 22:45903233-45903255 CCTGCTGCTGAGGGGGTCCCAGG + Intergenic
950199014 3:11029509-11029531 CCTGCCCTCCAGAGGCTCCCAGG + Intronic
950491520 3:13307967-13307989 TCCACTTCCCACAGGGTCCCTGG - Intergenic
950535981 3:13578427-13578449 CATGATTCCCAGAGAGTCCAGGG - Intronic
950560492 3:13718673-13718695 CCTGGTTCCCAGCGGGTGCCCGG - Intergenic
950647051 3:14383470-14383492 CCAGCCTCCCAGTGGCTCCCTGG - Intergenic
953386026 3:42506092-42506114 CCATCTTCCCACAGGTTCCCAGG + Intronic
953984092 3:47428103-47428125 CCTGCCTATCAGTGGGTCCCTGG - Intronic
954834982 3:53458434-53458456 CCTGCAACCCAGAGGCTCCCTGG - Intergenic
959392481 3:105793307-105793329 CCAGCTTCCCAGAGAGTGCTGGG - Intronic
961039129 3:123664436-123664458 CCAGCTTCCCTGAGGGTGCCAGG + Intronic
961172920 3:124811719-124811741 CCTGCTACCCACAGAGTCTCTGG + Intronic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
962207363 3:133446064-133446086 CCTGCTCCCCAGTGTGCCCCAGG + Intronic
964416738 3:156455725-156455747 TCTGCTTCCCAGCGAGTCTCTGG + Intronic
964887743 3:161503462-161503484 CCTTCTTCCCAGTGGGGCCTCGG - Exonic
965300442 3:167000099-167000121 CCTGCTTCTCAGAGTTCCCCAGG + Intergenic
965877953 3:173351177-173351199 TCTCCTTCCCTGAGGTTCCCTGG + Intergenic
967128561 3:186449135-186449157 TGAGATTCCCAGAGGGTCCCTGG + Intergenic
968135088 3:196215219-196215241 CCTGACCCCCAGAGGGTCACTGG - Intronic
969714738 4:8863058-8863080 CCCACTTCCCAGCGGGACCCTGG + Intronic
971321392 4:25608697-25608719 CCTTCTTCCCACAGTGTCCAAGG + Intergenic
971909149 4:32772305-32772327 CCTACTTCCCAGAAGGCCCTGGG - Intergenic
977042015 4:92028006-92028028 TCTGATTTCCAGTGGGTCCCTGG - Intergenic
978301177 4:107270666-107270688 GCTCCATCCCAGAGGATCCCTGG + Intronic
978620711 4:110632645-110632667 CCGGGTTGCCAGAGGGTCCGGGG - Intronic
982513321 4:156312101-156312123 CATCCTTCCCATAGGGTCCAAGG + Intergenic
983333297 4:166359271-166359293 CCTGCTGTTCAGTGGGTCCCAGG + Intergenic
984856246 4:184198459-184198481 CCTGCTTCTCAGAGGGGCAGTGG + Intronic
985726716 5:1520042-1520064 CCTGCTGCCCACTGGGTCCCTGG - Intronic
986002789 5:3643246-3643268 GCTGCCTCCTAGAGGGCCCCAGG - Intergenic
986738079 5:10682312-10682334 CATGCTTCCTACAGGGACCCTGG - Intronic
988732648 5:33988404-33988426 CCTGTTTCCCCGTGGGTCTCTGG - Exonic
990852718 5:60225030-60225052 CTTGCTTCCCAGGTGGTACCTGG - Intronic
991929042 5:71733573-71733595 TCTGCTTCCAAGATGGTGCCTGG + Intergenic
992019466 5:72607636-72607658 CCTGCCTCCCAGGGGGCCCTTGG + Intergenic
992778772 5:80109917-80109939 CCTGTTCCTCACAGGGTCCCTGG - Intergenic
993069009 5:83134835-83134857 CCTTCTGCCCAGAGGGTTCATGG - Intronic
994956991 5:106545237-106545259 CATGTCTCCCAGTGGGTCCCTGG + Intergenic
995625175 5:114068647-114068669 AGTGCTTCCCAGAGGGTCCAGGG + Intergenic
996083999 5:119285390-119285412 ACTCCTTCCCACAGGGACCCAGG - Intronic
996123294 5:119695232-119695254 CCTGCTTCCCAGAAAGCCTCAGG + Intergenic
996410602 5:123154886-123154908 CCTGCTTCCTGGATGGCCCCAGG + Intronic
997362236 5:133302506-133302528 AATGCCTCCCAGAGGCTCCCTGG - Intronic
997908064 5:137840252-137840274 CCTGCTTTACAGACTGTCCCTGG - Intergenic
997955461 5:138275338-138275360 CCTGATTCCCACAAGATCCCAGG + Intergenic
1001221215 5:169902608-169902630 CCAGCTTCCCAAATGGCCCCAGG - Intronic
1001485846 5:172119149-172119171 CCTTCTTCCCTGAGGTTCACAGG + Intronic
1001518373 5:172373230-172373252 CCTGCTTCCCAGCCTGTGCCTGG + Intronic
1001664785 5:173423629-173423651 CCTGCTTCACAGACCTTCCCGGG - Intergenic
1002078564 5:176724137-176724159 TCGGCTTCCCAGAGGGTTTCTGG + Intergenic
1004004743 6:11628428-11628450 CCTGGGTCCAAGAGGGTCCTAGG - Intergenic
1005840727 6:29743220-29743242 CCTGCTTCCCAAATGGCCCAGGG + Intergenic
1006296576 6:33172565-33172587 CCTGCTCTCCAGGGGGCCCCGGG + Exonic
1006296787 6:33173383-33173405 CATCCTTCCCAGGGGGGCCCTGG + Exonic
1006429154 6:33984508-33984530 CCTGCTTCCCCCAGCGCCCCTGG - Intergenic
1006452956 6:34115634-34115656 CTAGCTTCCCAAAGGGGCCCTGG + Intronic
1007360465 6:41351748-41351770 CCTGGTACCCAGAGGAGCCCAGG - Intergenic
1007370763 6:41425735-41425757 CCTGCCTCCTAGATGTTCCCTGG - Intergenic
1007487360 6:42190641-42190663 CCTGAGACCCAGAGGTTCCCAGG + Intronic
1008433226 6:51445376-51445398 CATGCTTCCCTCTGGGTCCCAGG + Intergenic
1011254370 6:85405794-85405816 CCTGCCTCTCAGAGGCACCCTGG - Intergenic
1013780654 6:113725342-113725364 CCTGCTTCCCAGATCTTCCTGGG + Intergenic
1013904091 6:115194937-115194959 CTTTCTTCCCAGGAGGTCCCTGG - Intergenic
1016447638 6:144150074-144150096 CCCGCGTCCTCGAGGGTCCCAGG + Intergenic
1017738799 6:157386399-157386421 ACAGCTTCACAGAGGTTCCCTGG - Intronic
1017739991 6:157398092-157398114 CCGGCTCCCCAGATGGCCCCAGG + Intronic
1017775321 6:157676084-157676106 CCTGCATCCAGGAGGGCCCCAGG + Exonic
1017775337 6:157676139-157676161 CCTGCATCCGGGAGGGCCCCAGG + Exonic
1017905136 6:158752818-158752840 CCAGCTGCCCAGATGGCCCCTGG - Intronic
1019275191 7:172485-172507 CCAGCTGCCATGAGGGTCCCTGG + Intergenic
1019557919 7:1641779-1641801 CCAGCTTCCCGGAGGGGCCAGGG + Intergenic
1019577863 7:1746185-1746207 CCTGCGTTCCGGAGGGTCCCCGG - Exonic
1019716749 7:2542701-2542723 CCTGCTGCCCACAGGGCCCAGGG - Intronic
1019918236 7:4147092-4147114 CCTCATTCCCACAGGGTCCCTGG - Intronic
1020810733 7:12846893-12846915 CCTGCTACCCTGTGGGTCCCTGG - Intergenic
1021309990 7:19082727-19082749 CCTGCTGCCTGGATGGTCCCTGG - Intronic
1023852335 7:44157436-44157458 GCTGCCTCCCAGAGGCTGCCAGG - Intronic
1025216369 7:57060233-57060255 CCCTCTTCCCTTAGGGTCCCAGG - Intergenic
1025655013 7:63510497-63510519 CCGTCTTCCCTTAGGGTCCCAGG + Intergenic
1026914422 7:74111540-74111562 CAAGCGTCCTAGAGGGTCCCTGG - Intronic
1026979766 7:74519466-74519488 CCTGATTCCCAAGGGGTCACGGG + Exonic
1029543154 7:101196379-101196401 GCTCCTTCCCAGGGCGTCCCTGG - Exonic
1030256604 7:107516629-107516651 GCTTCGTCCCAGAGGGTCACTGG - Intronic
1031350618 7:120726271-120726293 CTTGTTTGCCAGAGGGGCCCTGG - Intronic
1032844198 7:135738746-135738768 CCTGCTCCCCAGAGGGGCTGTGG - Intronic
1033145705 7:138868769-138868791 CCTGCTTCCCACATCCTCCCTGG - Intronic
1034472845 7:151264799-151264821 CCAGCTTCCCAGCTAGTCCCGGG - Intronic
1034750382 7:153562687-153562709 CCAGCATCCCAAAGGGTCACTGG + Intergenic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035024361 7:155816310-155816332 CCTGCTTCACAGAGTGGCCCAGG - Intergenic
1035062399 7:156079316-156079338 CAGGCTTCCCACAGGCTCCCTGG + Intergenic
1035306267 7:157934683-157934705 CCTGCTTCCCAGAGCCTGCAGGG + Intronic
1035308188 7:157946880-157946902 CATGCCTCTCAGAGGGTCTCCGG - Intronic
1035604387 8:920117-920139 GCTGCTCCCCACAGAGTCCCAGG + Intergenic
1035876291 8:3193448-3193470 CCCGCTTCCCAGACGTTCCGTGG - Intronic
1036627378 8:10483300-10483322 CCTGGCTCCCTGAAGGTCCCGGG + Intergenic
1036646049 8:10611890-10611912 GCTGGTTCCCAGAAGGTCCTGGG + Exonic
1036768622 8:11564241-11564263 GCAGCTTCGCAGGGGGTCCCCGG + Exonic
1036812502 8:11877205-11877227 CCAGCTTCCCACATGTTCCCGGG - Intergenic
1038780052 8:30562415-30562437 CCTGCTCCCCACAGGCTCCGAGG - Intronic
1039438484 8:37578260-37578282 CCTCCTTGGCAGAGGGTCCAGGG - Intergenic
1040308220 8:46223296-46223318 CTACCTTCCCAGAAGGTCCCTGG + Intergenic
1040941059 8:52834114-52834136 AATCCTTCCCAGATGGTCCCAGG + Intergenic
1046337007 8:112803797-112803819 CCTGCTTCCCAGAAGTTTGCAGG + Intronic
1047753566 8:127900839-127900861 CCTGCCTTCCAGAAGTTCCCAGG - Intergenic
1048289760 8:133171718-133171740 ACTGCCTCCCTGTGGGTCCCTGG - Intergenic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1048860596 8:138722071-138722093 CGTCCTTTCCAGGGGGTCCCTGG + Exonic
1049446038 8:142632129-142632151 CCAGCTCCCCAGGGGGGCCCAGG + Intergenic
1049480922 8:142822202-142822224 CCTCCTTACCACAGGGGCCCTGG + Intergenic
1049557704 8:143291330-143291352 CCCGCTGCCCAGAGCGTCGCCGG + Intronic
1049597284 8:143490478-143490500 CCTCCTCCCCAGTGGGGCCCTGG + Intronic
1049758443 8:144321062-144321084 GCTGCTTCCCATTGGATCCCAGG - Intronic
1052019952 9:23514308-23514330 CCTGGTTCCCAGAGAGGCCAAGG - Intergenic
1052935785 9:34091957-34091979 TCTGCTTCCCACAGGGTTCTTGG + Intronic
1053201043 9:36151738-36151760 GCGGCTGCCCAGAGGGACCCCGG - Intronic
1053280393 9:36816694-36816716 GCTCCTTCCCAGAGCCTCCCTGG - Intergenic
1053415954 9:37946845-37946867 CCAGCACCCCAGAGGGTCCCTGG + Intronic
1054188827 9:61972620-61972642 CCTGCGTGCCAGAAGTTCCCAGG + Intergenic
1056067157 9:82948397-82948419 CCTGGTTCACAGGGGGTCCTGGG - Intergenic
1056243407 9:84670420-84670442 TCTGCGCCCCAGAGAGTCCCGGG + Exonic
1056954975 9:91074408-91074430 CCAGCTTCCCAGGGGCTCCTGGG + Intergenic
1057142433 9:92735498-92735520 AATGCTTCACAGAGAGTCCCTGG - Intronic
1058053308 9:100427306-100427328 CCTGCTTGCGAGAGGAGCCCAGG + Intronic
1058530467 9:105900950-105900972 TCAGCTTCCCAGAGGGTTCAAGG + Intergenic
1060278169 9:122197939-122197961 GCTGCTTGCCAGAGTGTGCCAGG + Intronic
1061125922 9:128675690-128675712 TCTGGTTCCCAGAGGGAGCCTGG + Intergenic
1061271639 9:129547104-129547126 CCCTCTCCCCAGAGGGCCCCAGG + Intergenic
1061330580 9:129889921-129889943 CCTGCCTGCCAGATGCTCCCAGG + Exonic
1061486437 9:130922810-130922832 CCTGCTCCTCAGATGTTCCCTGG + Intronic
1061661080 9:132130739-132130761 CCCTCTTCCCAGAGGGTACCTGG + Intergenic
1061677965 9:132229082-132229104 CCTGCTTCCCTGGGAGTCCCCGG + Intronic
1061872562 9:133528574-133528596 CCTGCTCCCCAGCGTGGCCCAGG - Intronic
1061873613 9:133533369-133533391 CTTGCCTGCCCGAGGGTCCCGGG + Intronic
1062393080 9:136341701-136341723 CCTGCCTCCCAGAACGTACCTGG + Intronic
1062702557 9:137915057-137915079 CCTGCTTTACAGAGGGGCCCAGG + Intronic
1203634079 Un_KI270750v1:95289-95311 CCTCCTTCAGAGAGGCTCCCTGG - Intergenic
1185456644 X:314111-314133 GCGGCGTCCCAGAGGGTCCTCGG - Intronic
1185909774 X:3970933-3970955 CCAGCTTCCCCAAGGGTTCCAGG + Intergenic
1186514173 X:10153933-10153955 AGTGCTGTCCAGAGGGTCCCAGG + Intergenic
1186750826 X:12619796-12619818 CCTATTTCCCAGCAGGTCCCAGG - Intronic
1188243322 X:27813953-27813975 CTTGATTCTCAGAAGGTCCCTGG - Intronic
1188260751 X:28020345-28020367 TTTGCATCCCAGAAGGTCCCTGG - Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1189713772 X:43843685-43843707 CCTGCCTCCCACACGGTCCCGGG + Exonic
1190822274 X:53985030-53985052 CCTGCTTCCCAGCGCACCCCAGG - Exonic
1192142595 X:68658657-68658679 CCTGGCTCCCAGAGCTTCCCAGG - Intronic
1192148804 X:68699171-68699193 GCTGCTTCCCACAGGGACCTAGG - Intronic
1192503737 X:71668744-71668766 CTTCCTTCCCAGAGTGCCCCGGG - Intergenic
1194316011 X:92379072-92379094 CCTGGTTCCCACAGGCTCCATGG - Intronic
1196788370 X:119441682-119441704 CCTGCTTCCCAGATCTTCCTGGG + Intronic
1197800251 X:130340260-130340282 CCTGCTACCCAGAGGGTGAATGG + Exonic
1198420874 X:136470003-136470025 CCTGCTAGCAAGAGGGACCCTGG + Intergenic
1198582516 X:138081633-138081655 CCTGCTTTCCAAGGGGTCCCAGG + Intergenic
1198636492 X:138707434-138707456 CCTGCTTTCCAGAGTGCCTCAGG - Intronic
1200042557 X:153380535-153380557 CCAGCTTACCAGTGTGTCCCAGG + Intergenic
1200624060 Y:5490646-5490668 CCTGGTTCCCACAGGCTCCATGG - Intronic