ID: 961555133

View in Genome Browser
Species Human (GRCh38)
Location 3:127691970-127691992
Sequence CTTTATGCAAAAAAAGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 838
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 770}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961555133_961555135 -3 Left 961555133 3:127691970-127691992 CCTTTCTCTTTTTTTGCATAAAG 0: 1
1: 0
2: 6
3: 61
4: 770
Right 961555135 3:127691990-127692012 AAGTGTCTAACCATTAAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 79
961555133_961555134 -7 Left 961555133 3:127691970-127691992 CCTTTCTCTTTTTTTGCATAAAG 0: 1
1: 0
2: 6
3: 61
4: 770
Right 961555134 3:127691986-127692008 CATAAAGTGTCTAACCATTAAGG 0: 1
1: 0
2: 1
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961555133 Original CRISPR CTTTATGCAAAAAAAGAGAA AGG (reversed) Exonic
900017735 1:164792-164814 CTATAAGAAAAAAAAGAAAAAGG + Intergenic
900047994 1:523388-523410 CTATAAGAAAAAAAAGAAAAAGG + Intergenic
901894075 1:12293917-12293939 CTTTCTGTAAAAAAAGATAAGGG + Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
903438532 1:23369978-23370000 CTATCTGCAAAACAAAAGAAAGG - Exonic
903769407 1:25754416-25754438 CTTTTTGCAAGACCAGAGAAAGG - Intronic
903839520 1:26228342-26228364 CATTTTGCAGAAAAAAAGAAAGG - Intergenic
905590900 1:39162373-39162395 GTATATGCAAAGGAAGAGAAGGG - Intronic
906343546 1:45001557-45001579 CTCTATCCAAAAAAAAAAAAAGG - Intergenic
907536081 1:55159030-55159052 TTTTATTCAATAAAAGAGATTGG - Exonic
907542604 1:55229773-55229795 AATTTAGCAAAAAAAGAGAAAGG + Intergenic
908080357 1:60570797-60570819 CTTTCTGCAAAAGAATACAAGGG - Intergenic
908407223 1:63827046-63827068 CATTATGAAAAAAAGGATAACGG - Intronic
908613695 1:65892815-65892837 CTCTGTAGAAAAAAAGAGAAGGG - Intronic
908992569 1:70110805-70110827 CTTTCTGAAAGAAACGAGAATGG + Intronic
909098071 1:71314624-71314646 CTTTCTGCAAAAGAAAAAAAAGG - Intergenic
909202283 1:72705678-72705700 CTTTCTGCACATAAAGAGGATGG - Intergenic
909298146 1:73977844-73977866 ATTTATCCAAAAAAAAAAAAAGG - Intergenic
909982117 1:82115576-82115598 CTTTATCTAGAAAAAGAGAATGG + Intergenic
910397924 1:86810304-86810326 ATTTATGCTAAATAAGAGTAAGG - Intergenic
910540959 1:88356377-88356399 CTCTATGCACAAAAAATGAAAGG + Intergenic
910626231 1:89311102-89311124 CTTTGTGCAGAAAAGGTGAATGG - Intergenic
910791189 1:91052900-91052922 CTTTATGCAAAGAAAGACTTAGG + Intergenic
911116720 1:94253268-94253290 CCTTATAAAATAAAAGAGAATGG - Intronic
911426251 1:97717403-97717425 TTTTAAGCCAAAAAAGAGAATGG - Intronic
911580213 1:99625423-99625445 CATTATGCAAAAACAGAACAGGG + Intergenic
911907657 1:103589955-103589977 CTTTAGGCAAGAAAAAAAAATGG + Intergenic
912349963 1:109002905-109002927 CTCTATGGAAAAAAACAGTATGG + Intronic
912364587 1:109122658-109122680 CTTTAAAAAAAAAAAGAGACTGG + Intronic
912785015 1:112594190-112594212 TTTTCTGTAAAATAAGAGAAAGG - Intronic
913050909 1:115115882-115115904 CTTTATGGAGAAAAAAAAAAAGG - Intergenic
913121631 1:115747171-115747193 CTATTGGCAAAAAAAGAAAAAGG - Intronic
913176028 1:116273939-116273961 TGTTATCCAAAAAAAGAGAAAGG + Intergenic
913508168 1:119538348-119538370 ATTTTTGCAAAAAAAGAGGGTGG + Intergenic
914731087 1:150370895-150370917 CTTTATGTATAAAAATAGAAGGG + Intronic
915318615 1:155043632-155043654 CTTTGTGTAAACAAAGACAAAGG - Intronic
915629526 1:157141069-157141091 CTTAAATTAAAAAAAGAGAAAGG + Intergenic
916185423 1:162127522-162127544 CTTTATAAAAAAAAAAAAAAAGG + Intronic
916622484 1:166515246-166515268 ATATTTGCAAAAAAAGAGATTGG - Intergenic
916628247 1:166583160-166583182 CTTTTTCCAGCAAAAGAGAAGGG + Intergenic
916847389 1:168666558-168666580 TTTTGTGGAAGAAAAGAGAATGG - Intergenic
918052278 1:180984542-180984564 CTGTCTCAAAAAAAAGAGAAAGG + Intronic
918280760 1:183003082-183003104 TTTTTTACAAAAAAAAAGAAAGG + Intergenic
918335098 1:183502108-183502130 CATTAAACAAAAAAAGAAAAAGG + Intronic
918360770 1:183755514-183755536 CTTTTTAAAAAAAAAGAGCAAGG + Intronic
918830416 1:189389217-189389239 ATTTATTCAAAATAAAAGAAAGG - Intergenic
918939211 1:190969622-190969644 CATAAAGCAAAACAAGAGAATGG - Intergenic
919297058 1:195715727-195715749 CTTTAAGAAAAAAAAAATAACGG - Intergenic
919301523 1:195774520-195774542 ATTTATGAAAAAAAAGAGTCTGG - Intergenic
919459584 1:197860431-197860453 ATTTATGAAAAAAAAGGGCATGG - Intergenic
919948546 1:202341202-202341224 CTTGATACAAAAAAAGACTAGGG - Intronic
920042533 1:203111584-203111606 CTTCATGAAAAAAGAGAAAATGG + Intronic
920317234 1:205085726-205085748 CTTCATTCAAAAAAAAAAAAAGG + Intergenic
920329550 1:205196118-205196140 ATTTATGCATAAAAAGTGATAGG + Intronic
921013520 1:211166107-211166129 CTTTTTTAAAAAAAAAAGAAAGG + Intergenic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921240106 1:213171183-213171205 CTTTTTGCAAAAGCACAGAAAGG + Intronic
921486299 1:215719617-215719639 CTTTTTGAAAAAACAGAGACTGG - Intronic
921847549 1:219900129-219900151 ATTTATGCAAAATGAGAAAAAGG + Intronic
921870500 1:220134628-220134650 TTTGAAGTAAAAAAAGAGAAAGG + Intronic
922672026 1:227517276-227517298 CTTAAGACAAAAAAAGTGAAAGG - Intergenic
922951897 1:229565238-229565260 ATATATACAAAAAAAAAGAAGGG - Intergenic
923224625 1:231927743-231927765 TTTTATGCAACAAAGGAGATAGG + Intronic
923261367 1:232271087-232271109 CTTTATGGTAGAAAAGAGAAAGG + Intergenic
923589599 1:235307442-235307464 CTCTTTACAAAAAAAGAAAAAGG + Intronic
923697204 1:236264837-236264859 CTGTCTCCAAAAAAAAAGAAGGG + Intronic
923843067 1:237695816-237695838 CTCTATGTAAAAAATGGGAAAGG - Intronic
924097669 1:240570840-240570862 ATTAATGTAAAAAGAGAGAAAGG - Intronic
924538274 1:244957155-244957177 CAATTTGCAAATAAAGAGAAGGG - Intergenic
1062994601 10:1854023-1854045 CTTGATACAAGAACAGAGAACGG - Intergenic
1063196560 10:3749061-3749083 CATTATGAAAAAAAATATAAAGG + Intergenic
1063236277 10:4119871-4119893 CTTTAGACAGAAAAAGAGATAGG - Intergenic
1063897913 10:10701660-10701682 GTTTGTGCAAAGACAGAGAAAGG + Intergenic
1064087083 10:12353171-12353193 TTTCATTCAAAACAAGAGAAGGG - Intronic
1064433150 10:15288629-15288651 ATTTATGAATAAACAGAGAAAGG + Intronic
1064435950 10:15311405-15311427 CTTGCTGCAAAAATAGGGAATGG + Intronic
1065502429 10:26395218-26395240 TAATAGGCAAAAAAAGAGAAAGG - Intergenic
1066132892 10:32411480-32411502 CTATCTGCAAACTAAGAGAAAGG - Intergenic
1066137871 10:32469096-32469118 CTTTCTGGGAAAAAAGATAAAGG - Intronic
1066138616 10:32479146-32479168 CTATTTGCAAAAAAAGAAAGAGG - Intronic
1066481643 10:35801391-35801413 CTTCATGCTATAAAAGTGAAAGG - Intergenic
1066995398 10:42558456-42558478 CAGTATGCAAAAATAGAGAAAGG - Intergenic
1067217977 10:44318329-44318351 CTGGGTGCAAAAAAAGTGAATGG - Intergenic
1067259627 10:44677356-44677378 CTTTAGGCAAAGAACAAGAAGGG - Intergenic
1067675432 10:48371414-48371436 CTTAATGCAACAAATGACAAGGG - Intronic
1068161160 10:53266302-53266324 GTTTATACAAAAAATGTGAAAGG + Intergenic
1068414414 10:56699453-56699475 CTGTATGAAAAAAAAGACATGGG + Intergenic
1068647500 10:59484432-59484454 CTTTATTAAAAAAAAAAAAAAGG - Intergenic
1068922250 10:62496999-62497021 CTTTATCAAAGAAAAGAGCAAGG + Intronic
1069007147 10:63330373-63330395 ATTTATGTAAAAGAAGAAAATGG + Intronic
1069524759 10:69159890-69159912 CTTTAATAAAAAAAATAGAAGGG - Intronic
1069786357 10:70990693-70990715 CTTTCTGTAAAACAAGACAAAGG - Intergenic
1070444504 10:76482904-76482926 CATTATGCCAAAAATGAGCAAGG - Intronic
1070708509 10:78659077-78659099 CTTTCTGCAACTAATGAGAAAGG - Intergenic
1071162913 10:82772064-82772086 GTTAATTCAACAAAAGAGAAAGG - Intronic
1071330024 10:84549820-84549842 GTTGATGCAATAAAATAGAAAGG + Intergenic
1071774636 10:88771743-88771765 CTATATTCAAAAAAAAAAAAAGG - Intronic
1072067447 10:91884654-91884676 CTTTATTAAAAAAAAGCGCAAGG - Intergenic
1072200430 10:93153034-93153056 ATTTCTGCAAAAAAAGACATTGG - Intergenic
1073408935 10:103323594-103323616 CTATATCAAAAAAAAGAAAAGGG - Intronic
1073580357 10:104660043-104660065 CTGTGTGAGAAAAAAGAGAAAGG - Intronic
1075030258 10:119019705-119019727 CAATTTGGAAAAAAAGAGAAAGG - Intergenic
1075055084 10:119212151-119212173 CTTTAAAAAAAAAAAAAGAAAGG - Intronic
1075350134 10:121716757-121716779 CTTTTTGATAATAAAGAGAAAGG - Intergenic
1075449468 10:122539568-122539590 ATTTATACAGAAAAAGAGGAAGG + Intergenic
1076458855 10:130624278-130624300 CTAGAGGCAAAAAAAGAGAGTGG - Intergenic
1076642064 10:131924688-131924710 ATTTTTGCAAAAAAAAAAAAAGG + Intronic
1077765883 11:5160129-5160151 CTATATCCAAAAAAGTAGAAAGG - Intronic
1078113204 11:8417604-8417626 CTCTTTGCAAAAACAGAGAATGG - Intronic
1078735801 11:14019746-14019768 TTTTATGGAATAGAAGAGAAAGG - Intronic
1078996415 11:16705307-16705329 CTTTATGCATATAAGCAGAAGGG - Intronic
1079107806 11:17584368-17584390 CTTTATCCAAAACAAGACGAAGG - Intronic
1080410237 11:32016655-32016677 CTTTATGCATTAAAATGGAAAGG + Intronic
1081058592 11:38443620-38443642 CTTTATGTAAGTAGAGAGAAAGG - Intergenic
1082173441 11:49033985-49034007 CTTTACGCAGAAAAAAGGAAAGG + Intronic
1082889276 11:58121382-58121404 CTTTGGGAAAAAAAAGAGATGGG - Intronic
1083000521 11:59287039-59287061 ATTTGTGTAAAAACAGAGAAGGG - Intergenic
1083009102 11:59377830-59377852 CTCTCTGCAAAAAAGGAAAAGGG + Intergenic
1083084029 11:60124069-60124091 TTTTATGGAAAAAAAGGCAATGG - Intergenic
1083208479 11:61167480-61167502 TTTTAAGGAAAAACAGAGAACGG - Intergenic
1083448100 11:62724111-62724133 CTTTTTCCAATAAATGAGAAAGG + Intronic
1084158957 11:67334195-67334217 CTTGTCTCAAAAAAAGAGAAGGG - Intronic
1084300517 11:68247893-68247915 CTATAAGTAAAAAAAGAAAAAGG + Intergenic
1084813711 11:71632237-71632259 CTTCATGAAAAAAAAGGTAAAGG - Intergenic
1084988984 11:72905250-72905272 CTTTTTGAAAAAAAGGAGAGCGG - Intronic
1085293461 11:75416936-75416958 TTATAAGGAAAAAAAGAGAATGG - Intronic
1085501213 11:77026396-77026418 CATTAAGCAAAAATAGATAATGG - Exonic
1085649846 11:78257813-78257835 CTTCATCCAAAAAAAAAAAATGG - Intronic
1085878018 11:80432219-80432241 AATTATGCAAACAATGAGAAGGG - Intergenic
1085962900 11:81483790-81483812 GTTTGTGCAAAAGAAGGGAATGG + Intergenic
1086373821 11:86180476-86180498 ATTTATGAAACAAAACAGAAGGG - Intergenic
1086581061 11:88399066-88399088 CTTTCTGTAAGAAATGAGAAAGG - Intergenic
1086692322 11:89802071-89802093 CTTTATGCAGAAAAAAGGAAAGG - Intronic
1086713477 11:90037588-90037610 CTTTATGCAGAAAAAAGGAAAGG + Intronic
1088245300 11:107812510-107812532 CTTTAAGAAAAAAAAGAGGGAGG + Intronic
1088351935 11:108899494-108899516 CTTTTTACAAAAAAAAAAAAAGG - Intronic
1089287196 11:117415263-117415285 TTTTATGCAAATAAAAAGAAGGG + Intergenic
1089711659 11:120319246-120319268 CATAATGCAAAAAATGGGAAAGG - Exonic
1089797422 11:120993158-120993180 TTTTATTCAAAACAAGAGATAGG - Intergenic
1090283400 11:125477849-125477871 CTTTATGCAAAAAAAAAAAAAGG + Intronic
1090721520 11:129478965-129478987 CTTTCTGTAAAAAAAAATAAGGG - Intergenic
1090822032 11:130351258-130351280 CTTCCCGCAAAAAAAGAAAAAGG + Intergenic
1091579611 12:1775858-1775880 CTTTATGGAGAGAAAGAGAAAGG - Intronic
1091720985 12:2813285-2813307 ATTTATTTAAAAAACGAGAAGGG - Intronic
1091846903 12:3663470-3663492 TTTTATGCAGAAGAAGAGTAAGG - Intronic
1091947897 12:4565246-4565268 GTTCATGCATAAAAAAAGAAAGG + Intronic
1092225848 12:6748004-6748026 GTTTATGGAATAAAGGAGAATGG - Exonic
1092505775 12:9098157-9098179 AGTTATGCAAAATAAAAGAAAGG - Intronic
1093662265 12:21771020-21771042 ATTTTAGCAACAAAAGAGAAAGG - Intronic
1093697425 12:22177738-22177760 CTTTATGCAAAAATACAAAATGG + Intronic
1093716210 12:22385153-22385175 CTTCCTGGAAAAAAAAAGAATGG - Intronic
1093811356 12:23496067-23496089 CTTTAAGAAAAAAAAAACAAAGG + Intergenic
1093922591 12:24876098-24876120 CTAAAAGCAAAAAAACAGAATGG + Intronic
1094759097 12:33508758-33508780 ATTTAGCCAAAAAAAGAAAAAGG + Intergenic
1095296163 12:40529991-40530013 CCTAATGAAAAAAAAAAGAAGGG - Intronic
1095410822 12:41919877-41919899 CATTATGAAAAAGAAGAGAAGGG + Intergenic
1095431744 12:42142177-42142199 CTTTCTGTAAAGAAAGATAAGGG - Intronic
1095728967 12:45484246-45484268 CTACATGCAAAAAAAGAAATTGG - Intergenic
1096011775 12:48223392-48223414 CATTATGCAAGGAAAGGGAAAGG - Intergenic
1097293961 12:57943331-57943353 CTTATTGTAAAAAAAGAGAAGGG + Intronic
1098135144 12:67394150-67394172 CATTTTGTAGAAAAAGAGAATGG + Intergenic
1098367860 12:69723948-69723970 CTTTAGGTAACAAAAGATAATGG - Intergenic
1098537071 12:71604981-71605003 TTTGATGCAGAAAAAGAGACGGG + Intergenic
1098672488 12:73248629-73248651 CTATATTTAAAAAAAGAGACTGG - Intergenic
1099676336 12:85765334-85765356 CTTTTTGCAAATAAAGAGTGAGG + Intergenic
1099823140 12:87740811-87740833 CTTTATGAAGAAGAAGAAAAAGG + Intergenic
1099896000 12:88647679-88647701 CTGTATAGAAAAAAAGAAAACGG - Intergenic
1099994823 12:89767172-89767194 CTTTATAAAAAAAAAAAAAAAGG + Intergenic
1100466006 12:94845951-94845973 CTTCATGTAAAGAAAGAGAATGG + Intergenic
1100513443 12:95300854-95300876 CTTTTAGGAAAATAAGAGAAAGG + Exonic
1101019937 12:100543858-100543880 CTTTATGCAGAAAACTACAATGG + Intronic
1101058228 12:100942358-100942380 CTGTCTGCACACAAAGAGAAAGG - Exonic
1101103664 12:101419758-101419780 ATTTCTGCAAAAAAAAAAAAAGG + Intergenic
1101304463 12:103513952-103513974 CTTTATTCACAACATGAGAATGG - Intergenic
1102131124 12:110529582-110529604 CTTTACGGAAAAAAAAAAAAAGG + Intronic
1102941441 12:116946195-116946217 CTTTATGGGAGTAAAGAGAATGG - Intronic
1103431463 12:120890697-120890719 CTTTAAGGGAAAAAAGGGAAGGG + Intronic
1103589881 12:121984212-121984234 CTTTCTGCGAAAGAAGGGAATGG - Intronic
1103598614 12:122039869-122039891 CTGTATTCAAAAATAGAGACAGG + Intronic
1105491684 13:20894278-20894300 CTTTATTCTGAAAAAGAGATAGG - Intronic
1105959108 13:25312666-25312688 CTTTAAGAAAAACAAAAGAATGG - Intronic
1106289264 13:28345444-28345466 CTTTATCCGAAAAATGAAAAGGG - Exonic
1106738290 13:32610989-32611011 CTTTATGAAAAAAAAAAAGATGG - Intronic
1107005844 13:35610488-35610510 CTATATCCAAAAAAAAGGAAGGG + Intronic
1107052800 13:36070104-36070126 CATTATGCAACAAATGTGAATGG - Intronic
1107165557 13:37278781-37278803 CATTATTAAAAAAAAGAGTATGG - Intergenic
1107598697 13:41990701-41990723 TTTTATGGAAATAAAGAGGAGGG - Intergenic
1107752037 13:43577980-43578002 CTATATAAAAAAAAGGAGAATGG + Intronic
1108319003 13:49268658-49268680 CTATCTCCAAAAAAAGAAAAAGG + Intronic
1108368094 13:49738064-49738086 CCTTATGCAAAAATACAAAATGG - Intronic
1108753938 13:53477275-53477297 CTTTCTCCAAGAATAGAGAAAGG - Intergenic
1109158534 13:58942752-58942774 CTTTTGGAAAACAAAGAGAAAGG - Intergenic
1109216001 13:59590657-59590679 CTCAAAGAAAAAAAAGAGAAGGG + Intergenic
1109547359 13:63846056-63846078 CTCTATGAGATAAAAGAGAAAGG - Intergenic
1109700310 13:66016331-66016353 CTTTATGAAAAAAAAGGTATAGG - Intergenic
1109821061 13:67655361-67655383 CTTTATGCAGAAAAAGGGTGAGG + Intergenic
1110380743 13:74847807-74847829 CTTTATGCAAAAATACCCAAAGG - Intergenic
1110477718 13:75937121-75937143 CTGTATCCAAAAAAAGAAAAAGG - Intergenic
1110545080 13:76747057-76747079 CTCTATCCAAAAAAAAAAAAAGG - Intergenic
1110553542 13:76832939-76832961 CTCTATGAAAAAAATAAGAAAGG - Intergenic
1110734665 13:78922181-78922203 CATTATTAAAAAATAGAGAAAGG - Intergenic
1111426921 13:88097077-88097099 CTCTAAGAAAAAGAAGAGAAGGG + Intergenic
1111559037 13:89920100-89920122 CTTTAAGAAAACAAAGGGAAGGG - Intergenic
1111842690 13:93470675-93470697 ATTTCAGAAAAAAAAGAGAAGGG - Intronic
1111865683 13:93765204-93765226 CTTTTTTCATAAAAAGATAATGG - Intronic
1112590706 13:100761442-100761464 ATTTGTTTAAAAAAAGAGAAAGG - Intergenic
1112705393 13:102062110-102062132 GTCTATGCAAAAAATAAGAATGG + Intronic
1112791139 13:103003345-103003367 CTTTAAGCTCAAAAAGAAAAAGG + Intergenic
1112942262 13:104877946-104877968 CTTTTTGGAAAAAAAAAAAAAGG + Intergenic
1114863417 14:26556162-26556184 ATTTATACAAAAAAAGCAAAAGG + Intronic
1114870820 14:26656281-26656303 ATTTATATAAAAAAAGAAAACGG + Intergenic
1115616477 14:35100036-35100058 CTTTGTGTAAAAAGAGGGAAAGG - Intronic
1115714808 14:36091488-36091510 CTTAAAGGAAAAAAAGAGAATGG + Intergenic
1115759551 14:36565682-36565704 CTGTATCAAAAAAAAGAAAAAGG - Intergenic
1115857145 14:37642621-37642643 CTTCTTCCAAAAAAAGAGATAGG - Intronic
1115913425 14:38282206-38282228 CTATCTGCAAAAAAAAAAAAAGG + Intergenic
1116731203 14:48624520-48624542 CTTAATTGAAAAACAGAGAAAGG + Intergenic
1117300432 14:54420724-54420746 CTTTATGAAATAAATGTGAAAGG - Intergenic
1118012140 14:61620652-61620674 CTTAATGAGAAAAATGAGAAAGG - Intronic
1118452274 14:65913825-65913847 CTTTATACAAAAAGAGATAGTGG + Intergenic
1119807548 14:77491999-77492021 CTTTATTTAAAAAAAAAAAAAGG - Intronic
1120322278 14:82979321-82979343 GTTTATGCAATAAATGACAAGGG + Intergenic
1120382629 14:83800642-83800664 CTGTTTGAAATAAAAGAGAAGGG - Intergenic
1120660405 14:87241777-87241799 TTTTGTGCAAAGAAAGAAAAAGG + Intergenic
1120988879 14:90357401-90357423 GTTCCTGCAAACAAAGAGAATGG - Intergenic
1121157621 14:91701397-91701419 CTTTATGGAAAGAAAGTTAAGGG + Intronic
1121565085 14:94903461-94903483 CATTTTGCAAAAAGAAAGAAGGG + Intergenic
1121644046 14:95505659-95505681 CTATAAGAAAAAAAAGAAAAAGG - Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1122171163 14:99876768-99876790 CTGTAAGCAAAAAAGGAGGAGGG - Intronic
1202838432 14_GL000009v2_random:96914-96936 CTATATGAAATAAAAGATAAAGG + Intergenic
1202907798 14_GL000194v1_random:86979-87001 CTATATGAAATAAAAGATAAAGG + Intergenic
1202885418 14_KI270722v1_random:102160-102182 CTATATGAAATAAAAGATAAAGG - Intergenic
1123478169 15:20607036-20607058 TTTTAAGCAAAAAAAAAAAAAGG - Intergenic
1124458842 15:29870300-29870322 GGTTAAGAAAAAAAAGAGAAAGG + Intronic
1124559937 15:30762343-30762365 CTTAATACAAAAAAAGAGAAAGG + Intronic
1125288048 15:38115369-38115391 CTTGAGGCAAAAAAAGAGAAAGG + Intergenic
1125985763 15:44050227-44050249 CAGTGTGCAAAAAAAGAGAGTGG + Intronic
1126042174 15:44602201-44602223 ATTTAAGCAAAAAAAAAGAAAGG - Intronic
1126297878 15:47161604-47161626 CTTTTAGCAAAAAGAGAAAAGGG + Intergenic
1126607974 15:50499687-50499709 CTTTATTCTAAAAAAAAAAATGG + Exonic
1126803659 15:52323647-52323669 TTCTATGCCAAAAAAGTGAATGG - Intronic
1126812988 15:52427057-52427079 ACTTATGCATACAAAGAGAAAGG + Intronic
1127161654 15:56193351-56193373 TTTTATTCAAAAATAGAAAATGG - Intronic
1127790373 15:62392923-62392945 CTCTATGCAAAATCAGAGGATGG + Intronic
1128885057 15:71279189-71279211 CTTGATGCCAAAAATTAGAAAGG + Intronic
1129011251 15:72419678-72419700 CTCTATGCAAAGAAAAAGGAGGG + Intergenic
1130360490 15:83180298-83180320 CTCTATGCATAAGAAAAGAATGG + Intronic
1131162877 15:90119831-90119853 CTCTATGAAAAAAGAAAGAAAGG - Intergenic
1131333675 15:91526305-91526327 CTTTGTGTAAAAAGTGAGAATGG - Intergenic
1131336604 15:91555173-91555195 TTTTATGCAAGAGAAGAAAATGG + Intergenic
1131487859 15:92836984-92837006 ATTTGTTTAAAAAAAGAGAAAGG - Intergenic
1131538414 15:93256067-93256089 CTTTGTTCAAAAAAAAAGCAGGG - Intergenic
1132068486 15:98753229-98753251 CTTTATTTAAAAAAAAAAAAAGG - Intronic
1132116497 15:99140071-99140093 CTTTATTTAAAAAAATAAAAGGG - Intronic
1132852660 16:2031708-2031730 CTTGATGCCAGAAGAGAGAAGGG - Intronic
1133345799 16:5069717-5069739 CTTTATACATAAAAAGGGTAAGG + Intronic
1133425128 16:5681730-5681752 CGTAATGCAAAGAACGAGAAGGG + Intergenic
1133677792 16:8091730-8091752 CCTGGTGCAAAAAGAGAGAAAGG - Intergenic
1133908268 16:10041130-10041152 CTTTATCATAAAAAAGTGAAGGG + Intronic
1134604336 16:15558321-15558343 CTTTATGGAATAAAGGAGCAGGG + Intronic
1135011594 16:18885163-18885185 CTTGATGGAAACAAAGAGAGAGG + Intronic
1135318496 16:21472746-21472768 CTTGATGGAAACAAAGAGAGAGG + Intergenic
1135371389 16:21904541-21904563 CTTGATGGAAACAAAGAGAGAGG + Intergenic
1135440398 16:22466174-22466196 CTTGATGGAAACAAAGAGAGAGG - Intergenic
1135716445 16:24773011-24773033 CTTTATTAAAAAAATGAAAATGG - Intronic
1136328752 16:29554489-29554511 CTTGATGGAAACAAAGAGAGAGG + Intergenic
1136391594 16:29968655-29968677 TGTTATGCAAACACAGAGAAAGG + Intronic
1136443383 16:30294188-30294210 CTTGATGGAAACAAAGAGAGAGG + Intergenic
1138398282 16:56724835-56724857 CTGTATATAAAAAAATAGAAAGG - Intronic
1139538261 16:67593130-67593152 TTTTATACATATAAAGAGAAAGG + Intronic
1139890106 16:70246611-70246633 CTTGATGGAAACAAAGAGAGAGG + Intergenic
1140695712 16:77531489-77531511 GTTTCCACAAAAAAAGAGAATGG + Intergenic
1141358070 16:83367799-83367821 ATTTCTGTGAAAAAAGAGAAAGG + Intronic
1142294902 16:89214398-89214420 CTTTTTTTAAAAAAAAAGAAAGG + Intergenic
1142445928 16:90137663-90137685 CTATAAGAAAAAAAAGAAAAAGG - Intergenic
1142553845 17:758633-758655 ATGTATAAAAAAAAAGAGAAGGG + Intronic
1142920987 17:3185876-3185898 CTTTAAGCAGAAATAGAAAATGG - Intergenic
1143128915 17:4663709-4663731 CTGAATGCAACAAAAAAGAATGG - Intergenic
1143207526 17:5155257-5155279 CTTTATTGACACAAAGAGAACGG - Intronic
1143603517 17:7966275-7966297 CTTTAAGAATAAAAACAGAAAGG - Intergenic
1143831505 17:9655537-9655559 ATTTATGCAGAAAATGACAAAGG + Intronic
1143878529 17:10012016-10012038 CTTTGTTTAAAAAAAAAGAATGG + Intronic
1144293516 17:13850989-13851011 ATTAATGCAACAAAACAGAAAGG - Intergenic
1144851076 17:18244240-18244262 CTTTAAGAAAAAAAAAAAAAAGG - Exonic
1145027876 17:19482547-19482569 CTATATGAAAAAAAGAAGAAAGG - Intergenic
1145227302 17:21140890-21140912 TTTTAAGAAAAAAAAGAAAAAGG - Intronic
1145787366 17:27603030-27603052 TTTTCTGCAAAAAGAGAGACAGG - Intronic
1146193786 17:30793841-30793863 CTTTCTCAAAAAAAAAAGAAGGG - Intronic
1146457653 17:33019953-33019975 CTTTATGGAAATAAAGGGCAAGG + Intronic
1146499699 17:33353894-33353916 CTTTATTCACAGCAAGAGAATGG - Intronic
1147735890 17:42638059-42638081 CTTTTTGTAAAAATAGAGACAGG + Intergenic
1148057983 17:44813070-44813092 CTCAAAGAAAAAAAAGAGAAAGG - Intronic
1148348245 17:46918794-46918816 CATAATGCACAAAAAGACAAAGG - Intergenic
1148548066 17:48531717-48531739 ATTTATGCAAAGAGAGAGAGAGG - Intergenic
1148566290 17:48634835-48634857 CTTTTTTCAAAAAAAGTAAACGG - Intergenic
1148710114 17:49673658-49673680 CATTATACGAAAAAAGAAAAAGG + Intronic
1148853815 17:50567712-50567734 CTTTAAGGAAAATATGAGAAGGG - Intronic
1149010318 17:51849850-51849872 ATTCATGCAAAGAAAGAGAGTGG - Intronic
1149472751 17:56932240-56932262 CTTTTTCCAAAAAAAAAAAAAGG - Intergenic
1149713961 17:58769296-58769318 CTTTAAGTAAAAAGAGAGACTGG + Intronic
1149872829 17:60198591-60198613 CTTTATTGACACAAAGAGAACGG + Intronic
1150056268 17:62020226-62020248 CTTCATAAAAAAAAAAAGAAAGG - Intronic
1151584144 17:74998367-74998389 CTCTATTAAAAAAAAAAGAAAGG - Intronic
1151710371 17:75801508-75801530 CTTTATTTAAATAAAGAGACAGG - Intronic
1151776900 17:76210807-76210829 CTGTTTCAAAAAAAAGAGAAAGG - Intronic
1151847051 17:76663922-76663944 CTTTAGGCAAAAAAGGGGAAGGG + Intergenic
1152941836 17:83176926-83176948 ATGGATGCAAAAAAAGAAAATGG - Intergenic
1153208265 18:2728944-2728966 CTTTAGGGAAAAAAAAAAAAAGG + Intronic
1153259010 18:3203736-3203758 TTTTTTCCAAAAATAGAGAAGGG + Intronic
1153580233 18:6565600-6565622 CTGTCTCAAAAAAAAGAGAAAGG + Intronic
1155821900 18:30387781-30387803 CTTTTTGCAAAAGAAAAGAATGG + Intergenic
1155881906 18:31159852-31159874 CTTCATGCTAAAAATCAGAATGG - Intronic
1156264843 18:35478402-35478424 TTTTAGAAAAAAAAAGAGAAGGG - Intronic
1156680039 18:39577282-39577304 CATTAAGCAAAAAAAAAAAATGG - Intergenic
1156725562 18:40122137-40122159 TTTTAAGAAAAAAAAAAGAAAGG - Intergenic
1157438368 18:47690326-47690348 ATTACTGAAAAAAAAGAGAAGGG + Intergenic
1157799454 18:50607266-50607288 ATTTTTGCAGAAAAAGAAAATGG + Intronic
1157799804 18:50610006-50610028 ATTTTTGCAGAAAAAGAAAATGG + Intronic
1157939007 18:51905956-51905978 CTTTAAGTAAAAAAAAAAAATGG - Intergenic
1158487844 18:57883838-57883860 GTTTAAGCAAAAAAAAAAAATGG + Intergenic
1159198686 18:65153412-65153434 ATTTATGAAACAAGAGAGAAAGG - Intergenic
1159282756 18:66309008-66309030 CTTTATCCAAAAATACAGAATGG - Intergenic
1161369806 19:3904594-3904616 ATGTATGGAAAAAAAGAGAGAGG - Intronic
1162206841 19:9062611-9062633 CTTGATCTCAAAAAAGAGAAGGG - Intergenic
1162557887 19:11398963-11398985 GTTTATGAAGAAAAAGAGACTGG - Intronic
1164057920 19:21638144-21638166 CATTCCACAAAAAAAGAGAAAGG - Intergenic
1164295429 19:23905580-23905602 CTTGATGCAAAAAAAAAAGAGGG + Intergenic
1168299151 19:55393414-55393436 CTGTCTCCAAAAAAAGAAAAAGG + Intronic
1202634591 1_KI270706v1_random:33666-33688 CTATATGAAATAAAAGATAAAGG - Intergenic
1202651287 1_KI270707v1_random:6376-6398 CTATATGAAATAAAAGATAAAGG + Intergenic
1202660823 1_KI270708v1_random:69188-69210 CTATATGAAATAAAAGATAAAGG - Intergenic
925678840 2:6395572-6395594 GTTTGTGGAAAAAAAGAAAACGG + Intergenic
926781137 2:16473007-16473029 CTTTATGCAATGAAAGAGTCTGG - Intergenic
927067490 2:19488099-19488121 TTTTATGGAGAAAAAGACAAGGG - Intergenic
927634967 2:24807166-24807188 CTTTAATTAAAAAAAAAGAACGG - Intronic
928503952 2:31929308-31929330 ATATTTGCAAAAAAAGACAAAGG - Intronic
928889480 2:36186757-36186779 CTTTCTGCAAGCAAAGGGAATGG - Intergenic
928938925 2:36707854-36707876 CTTTAGGAAAAAAAAAAAAAAGG + Intronic
929152212 2:38757698-38757720 ATTTATGCATAAAAATACAATGG + Intronic
929207708 2:39316568-39316590 TTTCATGTAAAAAAGGAGAAAGG + Intronic
929621193 2:43355778-43355800 TTTAATGCAATAAAGGAGAAGGG + Intronic
930061389 2:47292084-47292106 CCTTTCTCAAAAAAAGAGAAGGG + Intergenic
930393433 2:50789875-50789897 CTTTATCCAAACTAAGAGCAGGG - Intronic
931322472 2:61184654-61184676 CTTTGTGCTTAAAAGGAGAAAGG + Intronic
931759890 2:65407244-65407266 CTTTTAGCAAAAAAAAAAAAAGG - Intronic
931944925 2:67295707-67295729 AATTATGCAAATAAAGAAAATGG + Intergenic
931978881 2:67673148-67673170 CTTTAGGAAAAAAGAGAGATGGG + Intergenic
932008287 2:67949669-67949691 CATTATGGAAAATAAGAAAAAGG - Intergenic
932138271 2:69250997-69251019 TTTTGAGGAAAAAAAGAGAAAGG - Intergenic
932197909 2:69800234-69800256 CCTTTTTCATAAAAAGAGAAAGG + Intronic
932977039 2:76615263-76615285 CTTAAATCATAAAAAGAGAATGG - Intergenic
933182573 2:79243952-79243974 CTTTCTGAAAAATAACAGAAAGG - Intronic
933187641 2:79296299-79296321 CTATATGAAATAAAAGAGATTGG - Intronic
933448867 2:82419834-82419856 CATTATTTAAAAAAAAAGAAAGG - Intergenic
933696242 2:85220253-85220275 CTTTAAGAAAAAAAAGAGGTGGG + Intronic
934076323 2:88431646-88431668 ATTTGTGCAAAAAAAAAAAAAGG - Intergenic
935314767 2:101820974-101820996 CTTTATTCTAAAACAGAAAAGGG - Intronic
936589734 2:113792243-113792265 CTTTATGCATAAAAATAGACAGG + Intergenic
937877231 2:126835031-126835053 CTTTATGAAGAAAAGGGGAAGGG + Intergenic
937901311 2:127021397-127021419 CTTTAGCCAAAAAAAGTAAATGG - Intergenic
939474910 2:142674508-142674530 TAGTAAGCAAAAAAAGAGAATGG - Intergenic
939616365 2:144365705-144365727 TTTTTTGCAAAAAAAGAAAAGGG - Intergenic
940145427 2:150540976-150540998 CTCTATGGAAAAAAAGAAAAAGG - Intergenic
940625289 2:156167669-156167691 CTTTTTCTAAAAAAAGAAAATGG - Intergenic
940812219 2:158258124-158258146 TTTTATGCAAGATAATAGAATGG + Intronic
941394059 2:164952443-164952465 CTTTCTGCAAAAAGTGAAAAAGG + Intronic
941394868 2:164961972-164961994 CTATATTCAAAAAGATAGAAGGG - Intergenic
941416940 2:165232659-165232681 TTTTATCCAAAAAAGGAGATGGG + Intergenic
941446867 2:165612031-165612053 TTTTATAGAAAAAAAGATAAAGG - Intronic
942073039 2:172332463-172332485 CTTGATTCAAATAAAGAGATTGG + Intergenic
942802703 2:179893740-179893762 ATTTATGCAGAGAAAGAGAAAGG - Intergenic
942869222 2:180714788-180714810 CTTTTTTTAAAAAAAGAAAAAGG - Intergenic
942915279 2:181297805-181297827 ATTTATTGAAAAAAAGATAATGG + Intergenic
943508957 2:188800650-188800672 CTTGGTGCAACCAAAGAGAAAGG + Intergenic
943599821 2:189902545-189902567 CTTTAAGGAAAAAATAAGAAAGG - Intronic
943885536 2:193212343-193212365 CTTTATCCAAAGAAGGGGAAAGG + Intergenic
943961819 2:194274326-194274348 GTTTATGCATAGGAAGAGAAAGG + Intergenic
944611797 2:201417153-201417175 CTTTTTCCAAACACAGAGAAAGG + Intronic
945165777 2:206942935-206942957 TCATATGCAAAAAAAGTGAATGG - Intronic
945229101 2:207565487-207565509 CTTAATGAAAAAAAAAAAAAAGG - Intronic
945459993 2:210095193-210095215 CTTTATTAAAATAAAGGGAAAGG - Intronic
945757789 2:213870797-213870819 CTTTCTACAAAAAGAGAGACAGG - Intronic
945828920 2:214759540-214759562 TTTTATGCAAAAAAAAATTAAGG + Intronic
945984141 2:216340653-216340675 CTTCATGGACAAAAAGGGAAAGG + Intronic
946829642 2:223715047-223715069 ATTTAAGTAAAAAAAGAGATAGG + Intergenic
946978980 2:225186019-225186041 CCTTCTGCAAAAAAACAAAATGG + Intergenic
947064875 2:226212679-226212701 GTTTTTGCAAAACAAGAAAAAGG + Intergenic
947323108 2:228944731-228944753 CTCTATGGACAAAGAGAGAATGG + Intronic
947340613 2:229134682-229134704 CTTTATGCCAAAAAAAAATAAGG - Intronic
947378765 2:229524642-229524664 CTTAATGGAAAAAAAGAGACTGG - Intronic
948919404 2:241054564-241054586 CCTCATACAAAAAAAGAAAATGG + Intronic
1169281286 20:4268975-4268997 CTTTATGGAAAAAAAATAAAAGG - Intergenic
1169464477 20:5825466-5825488 CTTTACGGAAAAAGACAGAAAGG - Intronic
1169555550 20:6745630-6745652 ATTTATGATAAAAAATAGAAAGG - Intergenic
1169560463 20:6794389-6794411 CTATATCCTAAAAAAGGGAAAGG + Intergenic
1169934019 20:10863966-10863988 TTTTAAGCAAAAATAGAGACGGG + Intergenic
1170413372 20:16114236-16114258 ATTGAAGGAAAAAAAGAGAATGG + Intergenic
1170576599 20:17667457-17667479 TTTGCTGCAAGAAAAGAGAAAGG - Intronic
1170583514 20:17716550-17716572 CTTTAAAAAAAAAAATAGAAAGG - Intronic
1170709213 20:18775101-18775123 CTTGAGGAAAGAAAAGAGAAAGG - Intergenic
1171186930 20:23129364-23129386 CATTAGGCAAAGAATGAGAATGG - Intergenic
1172267780 20:33631622-33631644 CTTGATGCAAAAGGTGAGAAAGG - Intronic
1172369829 20:34380622-34380644 TTTTTTGCAAAAATAGAGATGGG + Intronic
1173327292 20:42045787-42045809 CTTTGGGAAAAAAAGGAGAAAGG - Intergenic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1173725742 20:45296288-45296310 CCTTAGGAAAAAAAAGAAAAAGG + Intronic
1174250050 20:49212513-49212535 CTCAATGAAAAAACAGAGAAAGG - Intergenic
1174470167 20:50753068-50753090 CTTTAAAAAAAAAAAGAGAGAGG - Exonic
1174740413 20:53008182-53008204 CTTTATGAAGAAAAAAATAAAGG + Intronic
1174881776 20:54287654-54287676 GTTTATGCAGCAAAAGATAATGG - Intergenic
1175248330 20:57594441-57594463 GTTTTTGCAAAAAAAAAAAAAGG - Intergenic
1175380948 20:58563638-58563660 CTTTTTGGAAAAAAAAAAAAAGG + Intergenic
1175614886 20:60389530-60389552 TTTTAAACAAAAAGAGAGAAAGG + Intergenic
1175720576 20:61284340-61284362 CGTGATGCACAAAAAAAGAAAGG - Intronic
1176420070 21:6507109-6507131 CTGTATGCTAAAGAAGAAAATGG - Intergenic
1176627106 21:9101364-9101386 CTATATGAAATAAAAGATAAAGG + Intergenic
1176646813 21:9359437-9359459 CTATATGAAATAAAAGATAAAGG - Intergenic
1176740343 21:10595902-10595924 CTTTATGCAAAAAAAAAAAAAGG + Intronic
1177318133 21:19487666-19487688 CTACACACAAAAAAAGAGAATGG + Intergenic
1177476653 21:21632485-21632507 CCTTATGCAACAATAGAGCATGG - Intergenic
1177680805 21:24367633-24367655 CTTTATAAAAATAAATAGAAGGG + Intergenic
1177922891 21:27175283-27175305 CTTTATGCAGAAAAAGATGTCGG - Intergenic
1177970812 21:27787310-27787332 TTTTCTGCAAAAAAATATAAAGG - Intergenic
1178113538 21:29394418-29394440 CTTTGTCCAAATAAAGTGAATGG - Intronic
1178607149 21:34048488-34048510 CTTTATGCAAAAAATGAAATGGG + Intergenic
1179417634 21:41210962-41210984 CTTTGTGCAAGAACAGAGACAGG - Intronic
1179669779 21:42938583-42938605 GTTTATGGAAAAAAAGAAAGGGG + Intergenic
1179695562 21:43115429-43115451 CTGTATGCTAAAGAAGAAAATGG - Intergenic
1179782185 21:43708574-43708596 CTCTCTCCAAAAAAAGAAAATGG - Intergenic
1180328309 22:11452782-11452804 CTATATGAAATAAAAGATAAAGG - Intergenic
1180366115 22:11939562-11939584 CTATATGAAATAAAAGATAAAGG + Intergenic
1180417504 22:12781276-12781298 CTATATGAAATAAAAGATAAAGG + Intergenic
1181290212 22:21786036-21786058 ATTAGTGCAAAAAAAGTGAAAGG + Intronic
1181292334 22:21805633-21805655 CTTTAAGAAAAAAAAAAAAAAGG + Intronic
1182086728 22:27566061-27566083 CATTATGCATATAAAGAGACTGG + Intergenic
1182227764 22:28812851-28812873 CTTTATTCAACAAAACAGAATGG - Intergenic
1182956205 22:34429026-34429048 CTTTATGTGAAAAATGAAAATGG + Intergenic
1183131392 22:35840200-35840222 GTTTATGGAGAAAAAGAAAATGG - Intronic
1183794805 22:40107793-40107815 ATTTATGGATAAACAGAGAAAGG - Intronic
1183900245 22:41000101-41000123 CTTTGTGTAAAAAAAAAGGAGGG - Intergenic
1184940393 22:47760615-47760637 TTTAATGCAAAAAAGGAGATTGG - Intergenic
949327486 3:2882846-2882868 CTTAAGGAAAAAAAGGAGAAGGG - Intronic
949409395 3:3747524-3747546 CTTCATGCAAAAACATAGGAGGG + Intronic
949847249 3:8384295-8384317 CTTTATGAAAAAATAAATAAAGG + Intergenic
949995786 3:9615670-9615692 CGTTCTCTAAAAAAAGAGAAAGG + Intergenic
951079370 3:18433129-18433151 TCTTAGCCAAAAAAAGAGAAAGG + Intronic
951975357 3:28501229-28501251 CATTGTGCAAAAAATGAGATTGG + Intronic
952299330 3:32090022-32090044 TTTTGTGTAAAAAAAGAAAAGGG + Intergenic
952618733 3:35309161-35309183 TTTTGTGCTATAAAAGAGAATGG - Intergenic
952757405 3:36883527-36883549 CTTCATGCAAAAAAAAAAAAGGG + Intronic
953430249 3:42833777-42833799 CTGTATCCAATAAAAGAAAATGG - Intronic
953593695 3:44286229-44286251 CTTAATGACAAAAAGGAGAAAGG + Intronic
953655282 3:44846849-44846871 CTTTGTGAAAAATTAGAGAAAGG + Intronic
954203198 3:49037725-49037747 CTGTATCCAAAAAAAAAAAAGGG + Intronic
954227962 3:49195074-49195096 ATTTATGTAAAAATAGAGACAGG - Intergenic
954320072 3:49826487-49826509 ATTTCTGCAAAAAAAAAAAAAGG + Intergenic
955187927 3:56732753-56732775 CTATAAGAAAAAAACGAGAAAGG + Intronic
955424572 3:58774928-58774950 TTTTAAGAACAAAAAGAGAATGG - Intronic
955449029 3:59047849-59047871 GTTTATTCAAAAAATGGGAAGGG + Intronic
955574996 3:60351416-60351438 TTATATGCAGAAAATGAGAAAGG + Intronic
955775650 3:62430155-62430177 CTGCATACAAAAAAAGATAAGGG - Intronic
955939284 3:64132666-64132688 CTTTGTGGAAACAAAAAGAATGG - Intronic
956016253 3:64886408-64886430 CTTTATACAAAAAAAGCAAGAGG + Intergenic
956343047 3:68247873-68247895 TTCTATACAAATAAAGAGAAAGG - Intronic
956421774 3:69093357-69093379 CTTTCTGTAACAAAAGAGACAGG + Intronic
956498697 3:69857483-69857505 CCTTATGTGAAAAAAGAGGAAGG - Intronic
956877198 3:73475473-73475495 TTTTATGCAACAAAACATAATGG - Intronic
957093473 3:75754901-75754923 CTATATGAAATAAAAGACAAAGG + Intronic
957563369 3:81854879-81854901 CTATCTGCAAAAAAATAAAAAGG - Intergenic
958590074 3:96145521-96145543 ATTTATCAAAAAGAAGAGAAGGG + Intergenic
958677440 3:97284333-97284355 TTTTATGCAAAAAGAGAGAAAGG + Intronic
958723988 3:97881362-97881384 ATTTATGCAAATAGAGTGAATGG + Intronic
958809132 3:98839371-98839393 CTTCATGGAAAGAAATAGAAGGG - Intronic
958987434 3:100798615-100798637 CTTTATTCAAAAAGACAGATTGG - Intronic
959093941 3:101933463-101933485 CTTTGCAGAAAAAAAGAGAAGGG + Intergenic
960114576 3:113880312-113880334 CTGTATGTAAATAAAAAGAAAGG - Intronic
960814084 3:121655650-121655672 CTTTATTCAGAAAAGGAAAAGGG + Intronic
961555133 3:127691970-127691992 CTTTATGCAAAAAAAGAGAAAGG - Exonic
961710003 3:128820793-128820815 CTTTATGCCAGGAAAGAGAAAGG + Intergenic
962360319 3:134736637-134736659 CTTTATTCAAAAACATTGAAAGG + Intronic
962362998 3:134757105-134757127 CTTCATGCAAAAGATGAAAAAGG - Intronic
962893593 3:139694188-139694210 CTCTATGCAAAAAAGTAGCATGG + Intergenic
963097327 3:141557810-141557832 GGTTATAGAAAAAAAGAGAAAGG + Intronic
963302743 3:143617243-143617265 CTTTATTTATAAAAACAGAATGG - Intronic
963486436 3:145939804-145939826 CTTTATGCAAAAATAGCTTAAGG + Intergenic
963817254 3:149845371-149845393 CTTTTTGCTAAAAGAGAGAAAGG + Intronic
964191972 3:154013641-154013663 CTTTTTGCAAAGAAAGGGAGTGG - Intergenic
964273098 3:154979564-154979586 CTTTATGCACGAAGAGAGAGGGG + Intergenic
964600615 3:158496951-158496973 GCTTATGGAAAAAAAGAGAGAGG + Intronic
965012390 3:163111077-163111099 CTTTATACACAAAGAGAGATCGG - Intergenic
965591905 3:170368975-170368997 CGTTTTGTAAAAAATGAGAAAGG - Intronic
965775349 3:172224350-172224372 TTTAAAGCAAAAGAAGAGAATGG - Intronic
965907611 3:173728442-173728464 CTTTAACCAAAACAAGGGAAAGG - Intronic
966166480 3:177024333-177024355 CTTTATACAAAGCAAGATAACGG - Exonic
966294700 3:178406002-178406024 GTTTAATCAAAAAAAGATAACGG + Intergenic
966308195 3:178561700-178561722 CTTTATGCCAAAACTCAGAAGGG + Intronic
966624554 3:182002028-182002050 CTTTTAGCAGAAACAGAGAAAGG - Intergenic
966889404 3:184395685-184395707 CTTTAGGGAGAAAAAAAGAACGG + Intronic
966957268 3:184895638-184895660 CTTTAAAAAAAAAAAGAGAGTGG - Intronic
967058775 3:185853054-185853076 ATTTTTGCAAAAAAACAAAAAGG - Intergenic
967439041 3:189485652-189485674 CTTTATTCTAAGAAAGAGGAGGG - Intergenic
967827406 3:193888512-193888534 TTTTATACAAAAAAAAATAATGG + Intergenic
1202740074 3_GL000221v1_random:45603-45625 CTATATGAAATAAAAGATAAAGG + Intergenic
968769645 4:2496282-2496304 CTTTATGCTAAGAAACAAAAAGG + Intronic
968844906 4:3035591-3035613 CTTTTTTCAAAAATAGAGATGGG + Intronic
969795565 4:9525101-9525123 CTTCATGAAAAAAAAGGTAAAGG - Intergenic
970413719 4:15835963-15835985 TGTTAGGGAAAAAAAGAGAAAGG + Intronic
970466675 4:16330513-16330535 CTTTATCCAAAAACAATGAATGG - Intergenic
970640592 4:18061451-18061473 ATTTCTGCAAAAAAAAAAAAAGG + Intergenic
970773947 4:19650027-19650049 CTTAGTGTAAAAGAAGAGAAAGG - Intergenic
970833121 4:20366708-20366730 CTATAAGCAAAAGAAGAAAACGG + Intronic
970974363 4:22025867-22025889 CTAATTGCAAGAAAAGAGAAGGG - Intergenic
971430906 4:26566234-26566256 ATTTATGCAAAGACAGAGAAAGG + Intergenic
971546031 4:27888670-27888692 CTTTATGCTAAACAAGGGCAAGG - Intergenic
971759039 4:30740367-30740389 CCTTATGCAAAACAAAAGATGGG + Intronic
971767340 4:30850259-30850281 CTTCATGGAATAAAGGAGAATGG + Intronic
972091801 4:35295919-35295941 CATTAAGCAAAAAAAAAAAATGG - Intergenic
972417325 4:38854459-38854481 ATTTAAGCATAAAAAGAGGAAGG + Intronic
972473286 4:39427506-39427528 CTTGATACCAAAATAGAGAAGGG + Intronic
972611515 4:40659954-40659976 ATTTATGCAAAAAGAGATAAAGG - Intergenic
973002965 4:44974916-44974938 CTTTATGAAAAAACACACAAAGG + Intergenic
973072525 4:45881857-45881879 CTATATGCAAAAAAAAAAGATGG + Intergenic
973226276 4:47788683-47788705 CTTTATGCCAAAAATAAGCAAGG - Intronic
973248054 4:48031391-48031413 TTTTATTCAAATAAAGAAAATGG - Intronic
973307329 4:48667650-48667672 CTGTCTCCAAAAAAAAAGAATGG - Intronic
973364290 4:49196010-49196032 CTATATGAAATAAAAGATAAAGG - Intergenic
973396792 4:49600728-49600750 CTCTATGAAATAAAAGATAAAGG + Intergenic
973607189 4:52599609-52599631 CTATATGGAAAAAAGCAGAAAGG + Intronic
973789986 4:54368929-54368951 CTTTTTGCAAATGAAGAAAATGG - Intergenic
974450616 4:62052073-62052095 CTTTATGGATATAAAGAAAATGG - Intronic
974748039 4:66101919-66101941 ATTTATAAAGAAAAAGAGAAAGG - Intergenic
974765488 4:66339408-66339430 TTTGCTGCAAGAAAAGAGAAAGG - Intergenic
975228755 4:71906468-71906490 CTTTATGGGAAATAAGACAATGG - Intergenic
975281635 4:72568843-72568865 CTTTAAGAAAAAAAGGAAAAGGG + Intergenic
975929187 4:79497666-79497688 TTTTATCTAACAAAAGAGAATGG + Intergenic
976053659 4:81037268-81037290 TTTCATGCAACTAAAGAGAAAGG - Intronic
976550380 4:86387618-86387640 CATTATTCAAAAGAAGTGAAGGG + Intronic
977419942 4:96786709-96786731 CTTTATGCAAAAACAAATATTGG - Intergenic
977537815 4:98276482-98276504 CAATATGCAAAAAAAAAAAAGGG - Intronic
977649613 4:99454539-99454561 TTTCATGGAGAAAAAGAGAAGGG + Intergenic
977649738 4:99455353-99455375 TTTCATGGAGAAAAAGAGAAGGG - Intergenic
977656745 4:99531117-99531139 ATTTATGCAAAAAAAAACAAAGG - Intronic
977796650 4:101173758-101173780 CATTAAGAAAAAAAAGAGCATGG + Intronic
978045953 4:104127811-104127833 TTATATGAAAAAAAAGAGGAAGG + Intergenic
978125972 4:105135610-105135632 CCTTAAGCAATAAAAGAGAATGG - Intergenic
978288425 4:107107542-107107564 CTTTAAACAAACAAAGATAAAGG + Intronic
979092963 4:116510251-116510273 CTCTGTACAAAAAAAGATAATGG + Intergenic
979430076 4:120618891-120618913 CTTTATGTAGAAAAAAATAAAGG + Intergenic
979608658 4:122667279-122667301 CCCCATGCAAAAAAAGAAAAGGG - Intergenic
979738766 4:124123263-124123285 ATATTTTCAAAAAAAGAGAATGG - Intergenic
979797264 4:124861692-124861714 TTTTTTGCAAAAAAAAAAAAGGG + Intergenic
979827734 4:125260020-125260042 CTTTAAGAAAAGAAGGAGAATGG - Intergenic
980432361 4:132719841-132719863 ATTAATGAAAAAAAAGACAAAGG - Intergenic
980735500 4:136881450-136881472 CTTTTTTAAAAAAAACAGAAAGG - Intergenic
980786090 4:137557285-137557307 CTTTATGCAAATAACGTGAGAGG - Intergenic
980837995 4:138220747-138220769 CTTCATGTAAATAAACAGAAGGG + Intronic
981158742 4:141471752-141471774 CCTTCTGCAAAAAAAGAAAATGG - Intergenic
981982535 4:150811421-150811443 CTTTAGGAAAAAAAAAAAAAGGG + Intronic
983035278 4:162857358-162857380 CTTTTTCCAAAAATAGAGATGGG + Intergenic
983044861 4:162974217-162974239 CTTTATGAAGAAGGAGAGAAAGG - Intergenic
984936449 4:184893990-184894012 CTTGATACAAAAAAACACAATGG - Intergenic
985020684 4:185686189-185686211 CCTTATGAAAATAAAGAAAAAGG - Intronic
985436327 4:189932785-189932807 CTTAATAAAAAAAAAGAAAATGG + Intergenic
1202761598 4_GL000008v2_random:117039-117061 CTATATGAAATAAAAGATAAAGG - Intergenic
985751142 5:1676246-1676268 CTAAAAGCCAAAAAAGAGAAGGG + Intergenic
986807771 5:11324949-11324971 CTTTAGACAAAAAAAAAAAAAGG - Intronic
987011113 5:13766446-13766468 CTTTGTGCCAGAAAAAAGAAAGG + Intronic
987370498 5:17188376-17188398 TTCTATCAAAAAAAAGAGAAAGG + Intronic
987691488 5:21272597-21272619 ATATATACAAAAAAAGAAAATGG + Intergenic
987956462 5:24748000-24748022 TCTTTTACAAAAAAAGAGAAGGG - Intergenic
988015215 5:25547973-25547995 ATTTCTGCAAAAAAAAAAAAAGG + Intergenic
988343015 5:29999715-29999737 CTTAATACAAAAAAAGACAGAGG + Intergenic
988936427 5:36087541-36087563 ATTTGTTTAAAAAAAGAGAAAGG - Intergenic
989264739 5:39460013-39460035 CTCAATGAAAAACAAGAGAATGG - Intronic
990069784 5:51766997-51767019 CTAAATGCATAAAAATAGAAAGG - Intergenic
990700901 5:58474108-58474130 CTTGAGGGAAAAAAAAAGAAAGG - Intergenic
990868060 5:60401487-60401509 CCTTATGTTAAAAAAGAGGATGG + Intronic
990876324 5:60490484-60490506 TTTTAGGCAAAAGAAGATAATGG - Intronic
991189636 5:63854551-63854573 ATTTAAAAAAAAAAAGAGAAAGG + Intergenic
991639072 5:68735775-68735797 GTTTATAGAAATAAAGAGAAAGG + Intergenic
991748892 5:69777540-69777562 ATATATACAAAAAAAGAAAATGG - Intergenic
991800470 5:70357352-70357374 ATATATACAAAAAAAGAAAATGG - Intergenic
991828130 5:70652689-70652711 ATATATACAAAAAAAGAAAATGG + Intergenic
991892828 5:71356792-71356814 ATATATACAAAAAAAGAAAATGG - Intergenic
992168800 5:74081728-74081750 CATTATGCAAAATGAGAAAATGG + Intergenic
993130409 5:83890279-83890301 CTTTATGCATGAGCAGAGAAAGG - Intergenic
993207808 5:84907080-84907102 CTTGAAGGAGAAAAAGAGAATGG + Intergenic
993875114 5:93297454-93297476 AATGATGCAAAAAAAAAGAAGGG + Intergenic
994076607 5:95658501-95658523 CTTTCTTAAAAAAAAGAGAAGGG - Exonic
994279094 5:97878467-97878489 CTTTATTTAAAAAAATAAAAAGG - Intergenic
994307682 5:98226943-98226965 CTTTGTAGAAAAAAAGAAAATGG + Intergenic
994353492 5:98771181-98771203 CTTTCTGAAAACAAAGAGAAAGG + Intronic
994401970 5:99291709-99291731 CATTTTGCAGATAAAGAGAAAGG - Intergenic
995391732 5:111647378-111647400 CTTTATGCAGAAAGTGTGAATGG - Intergenic
995392615 5:111655127-111655149 CTTTATGCAACAAGAGAGGAAGG - Intergenic
996367490 5:122718569-122718591 CTTTCTGCATAAACAGAAAATGG - Intergenic
996511965 5:124326453-124326475 CTTTCTGGGAAAAATGAGAAAGG + Intergenic
996932128 5:128902564-128902586 CTATATGCAAAAAAAAAAAAAGG + Intronic
997357679 5:133274313-133274335 CATTTTGCAAAAGTAGAGAAGGG - Intronic
998307269 5:141091033-141091055 CTTTAGTCCAAAAAAGAGAGAGG + Intergenic
999065601 5:148682598-148682620 ATTTATTTAAAAAAAGAGAGAGG + Intergenic
999123469 5:149228404-149228426 CTTTTTGAAAAAAAATACAAAGG + Intronic
1000392439 5:160738843-160738865 CTTTAGGAAATAAAAGAGAAGGG + Intronic
1000720408 5:164699017-164699039 TTTTAGGTAAAAAAAGAAAAGGG + Intergenic
1000724369 5:164751362-164751384 CTTAATGTAAAAAAACAAAAAGG - Intergenic
1000810094 5:165850664-165850686 CATTATGCAAAAGGAGAGAGGGG - Intergenic
1001210520 5:169806623-169806645 GTTTATGTAAAATAAGCGAAGGG - Intronic
1001318220 5:170659564-170659586 CTCTATACAAAGAAGGAGAAAGG - Intronic
1001901762 5:175436817-175436839 CTTTCTGAAAGCAAAGAGAATGG + Intergenic
1002138630 5:177124788-177124810 CTTTAAGCAAAAACCGAGATTGG - Intergenic
1002165255 5:177340175-177340197 ATTTAGGCACAAAAAAAGAAGGG + Intronic
1002330411 5:178436834-178436856 CATTTTGCAAAAGAAGAGACTGG + Intronic
1002628970 5:180555975-180555997 GTTTAAGGAAAAAAAGTGAATGG - Intronic
1003361245 6:5427818-5427840 CTTAAACCAAAAAAAGAGCAAGG + Intronic
1003426479 6:6001373-6001395 TTTTTTGCAAAATAAAAGAATGG + Intronic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1003924346 6:10862676-10862698 TATGGTGCAAAAAAAGAGAAGGG - Intronic
1004662093 6:17719623-17719645 TTTTAGGGAATAAAAGAGAAGGG + Intergenic
1005049060 6:21666772-21666794 CTTTAAAGAACAAAAGAGAAGGG - Intergenic
1005212100 6:23478191-23478213 TATTCTTCAAAAAAAGAGAAAGG - Intergenic
1005481572 6:26259981-26260003 CCTGATGCAAAAACAGAAAAGGG + Intergenic
1005684123 6:28235604-28235626 CCTGATGCAAAAAAAGAAATGGG - Intergenic
1005793026 6:29326911-29326933 CTTCATGCAAAAAAAAAAAAAGG + Intergenic
1005962142 6:30701891-30701913 ATTTCAGCAAAGAAAGAGAAAGG + Intronic
1006346529 6:33486910-33486932 CTTTCTCCAAAAAGATAGAAAGG - Intergenic
1006661168 6:35646109-35646131 CTTTCTCAAAAAAAAGAGAGAGG + Intronic
1007276673 6:40679276-40679298 CTATATGCAAAGAAAAAGAGAGG + Intergenic
1007618574 6:43197460-43197482 CTTAAAACAAAAAAAGAGAAAGG - Intronic
1008603024 6:53114099-53114121 CTTTAGGTAAGAAAAGAGACAGG + Intergenic
1008665984 6:53716975-53716997 TTTTAGGCACAAAAAGATAAAGG + Intergenic
1009302775 6:62047675-62047697 CTTTCTGGAAAGAAAAAGAAGGG + Intronic
1010175036 6:73018090-73018112 TGTTATGCAGAAATAGAGAAGGG + Intronic
1011174851 6:84548992-84549014 CTTAATGAAAAAAAAAAAAAAGG + Intergenic
1011243281 6:85295587-85295609 TTTTGGGGAAAAAAAGAGAAAGG + Intergenic
1011300565 6:85868576-85868598 CCTTATTCAAAAATAGACAAAGG - Intergenic
1011323448 6:86122564-86122586 CTTTATGGAAAAATAGGCAAAGG + Intergenic
1011634492 6:89358333-89358355 CTCTATGCAAAAAAAGGGGGTGG + Intergenic
1011947908 6:92930243-92930265 TTTTATGCAAAAAGAAAGAAGGG + Intergenic
1012166209 6:95955695-95955717 CATTTTTTAAAAAAAGAGAAAGG + Intergenic
1012172328 6:96033114-96033136 CCTTATGCAGATAAAAAGAAAGG + Intronic
1012176461 6:96092774-96092796 CTGTTTCCAAAAAAAGAAAAGGG - Intronic
1012215833 6:96582394-96582416 CTTTAAGAAATAAAAAAGAAGGG - Intronic
1012430355 6:99157705-99157727 CTTTATTTAAAAAAAAGGAAAGG - Intergenic
1012499848 6:99876246-99876268 CTTTAAATAAGAAAAGAGAAAGG - Intergenic
1012553594 6:100486673-100486695 ATTTAGGCTCAAAAAGAGAAGGG + Intergenic
1013093196 6:106920108-106920130 ATGTATACAAAAAAAGAGTATGG + Intergenic
1013576153 6:111484376-111484398 CTTTATTCAAAAATCGAGAGGGG + Intergenic
1013600625 6:111701099-111701121 CTTTATAAAAAAAAGAAGAAAGG + Intronic
1013645473 6:112134930-112134952 TTTTTTAAAAAAAAAGAGAATGG - Intronic
1013881649 6:114909523-114909545 ATTCATGCAAATAAAGAGGATGG + Intergenic
1014958887 6:127657879-127657901 CTTTATACAAAGCAAGATAACGG - Intergenic
1015000644 6:128210284-128210306 GTATATGCATAACAAGAGAATGG - Intronic
1015079318 6:129204471-129204493 CCTTATGAAAAAAAAAAAAAAGG + Intronic
1015153297 6:130062795-130062817 CATTATTCAAAAAAAAAAAAAGG + Intronic
1015566871 6:134582014-134582036 CTTTTTGCAAAAAGAAGGAAAGG + Intergenic
1015853873 6:137603093-137603115 CTTTATGCAACAACAGAAAAGGG - Intergenic
1016010059 6:139130131-139130153 ATTCATTCAATAAAAGAGAATGG - Intergenic
1016170067 6:141002790-141002812 GTTAATGCAAGAATAGAGAAGGG - Intergenic
1016510815 6:144840877-144840899 CCGCATGCAGAAAAAGAGAAAGG - Intronic
1016626298 6:146173490-146173512 GTTTATTCACAAAAAGAGATGGG - Intronic
1016880578 6:148907597-148907619 CTTAGTGCAAAGAAAGAAAAGGG + Intronic
1016900479 6:149096242-149096264 TGTCATGGAAAAAAAGAGAAGGG + Intergenic
1017045299 6:150341639-150341661 CTAAATGGATAAAAAGAGAAAGG - Intergenic
1017159250 6:151349973-151349995 CTTTCTGGAAAGAAACAGAAAGG + Exonic
1017284515 6:152658691-152658713 CTCTATGGAAAAAAAAAAAAAGG + Intergenic
1017376820 6:153780312-153780334 ATTTCTGGAAGAAAAGAGAAAGG - Intergenic
1017489575 6:154933220-154933242 TTTTATGCAAGAAAAGAGCTGGG + Intronic
1017691306 6:156968274-156968296 CATTTTACAAAAAATGAGAAAGG + Intronic
1018024973 6:159798276-159798298 CTTGATTTAAAAAAACAGAAAGG - Exonic
1018327443 6:162687495-162687517 TTTTATGGAGAAATAGAGAATGG + Intronic
1019123960 6:169826740-169826762 ATTTATCCAAAAAAAAAAAAAGG + Intergenic
1019338562 7:496495-496517 CTTTATACAAAAAAGAAAAATGG + Intergenic
1020284061 7:6666604-6666626 CCACAAGCAAAAAAAGAGAATGG - Intergenic
1020680480 7:11231020-11231042 TTTTATGAAAAAGAAAAGAAAGG + Intergenic
1020817744 7:12926679-12926701 ATTTTTGCAAAGAAACAGAAAGG - Intergenic
1020973250 7:14974567-14974589 ATATAAGCAAATAAAGAGAAGGG + Intronic
1022059726 7:26781336-26781358 CTTTCTGGAAAAAAAAATAAAGG + Intronic
1022584370 7:31592105-31592127 CCTTACGCATAAAAAGAGTAGGG - Intronic
1022722817 7:32956666-32956688 CTGTCTCCAAAAAAAGAAAAGGG - Intergenic
1022855642 7:34310883-34310905 CTTTAGCCAAAAGGAGAGAAAGG - Intergenic
1022884119 7:34624128-34624150 CAAAATGCAAGAAAAGAGAAGGG + Intergenic
1023576462 7:41633371-41633393 CTTTATGTAAAAAAATAAATTGG - Intergenic
1023809827 7:43903288-43903310 ATTTATGTAAAAACAGAGCAAGG + Intronic
1024107318 7:46106371-46106393 CTTGAGACATAAAAAGAGAAAGG + Intergenic
1024533763 7:50413252-50413274 CATAATGCAAAAAAGGAGAATGG + Intergenic
1025620528 7:63166142-63166164 TTGTATGCAGAAAAAGAGCAAGG + Intergenic
1025760757 7:64388850-64388872 CTGTATGCATACAAAGAAAAGGG + Intergenic
1026183209 7:68060525-68060547 CTTTCTCCAGAAAAAGAGAGAGG + Intergenic
1026813792 7:73492863-73492885 CTTCATTAAAAAAAGGAGAAAGG - Exonic
1026999821 7:74644696-74644718 CTTTATACATGAAAAAAGAAAGG - Intergenic
1027703665 7:81501038-81501060 ATTTATTAAAAGAAAGAGAAAGG - Intergenic
1028157947 7:87453132-87453154 ATATCTGAAAAAAAAGAGAAAGG + Exonic
1028167599 7:87556488-87556510 CTTTATGTAGAAGCAGAGAAGGG + Intronic
1028247313 7:88496212-88496234 CTTTATGCAAAATAACACACAGG + Intergenic
1028258934 7:88636767-88636789 CTTTATGCAATAAAATTGTAGGG - Intergenic
1028506319 7:91574573-91574595 ACTTATGGAAAAAAAAAGAAAGG - Intergenic
1028697115 7:93727440-93727462 GTTTAAGCAGAAAAATAGAATGG - Intronic
1029093681 7:98068408-98068430 CTTTACTGAAAAAAAGAAAAAGG - Intergenic
1029096583 7:98089769-98089791 CTTTTTTAAAAAAAAGAGAGTGG - Intergenic
1029440761 7:100585621-100585643 AGATATGCAAATAAAGAGAAAGG + Intronic
1030360486 7:108590291-108590313 CCTGATGTAAAAAAAGAGATTGG + Intergenic
1031190067 7:118537676-118537698 TTTTATGAAATAAAAGAAAATGG + Intergenic
1031342915 7:120627237-120627259 TTTTATGTAGAAGAAGAGAAAGG + Intronic
1031934756 7:127725314-127725336 CTTTGTGCAAATTTAGAGAAGGG + Intronic
1032517001 7:132513986-132514008 CTTAATGAAATAAAATAGAAGGG + Intronic
1032615655 7:133467225-133467247 CATTCTGCAAAAAAAAAAAAAGG - Intronic
1033327038 7:140388426-140388448 CTGTACCAAAAAAAAGAGAAAGG + Intronic
1034829526 7:154297363-154297385 CTTTATTCACAAAATAAGAAGGG + Intronic
1034841747 7:154403949-154403971 CTTTTTTCAACAAAAGACAAAGG - Intronic
1035452432 7:158986206-158986228 CTTGATGAAAAAAATGGGAAAGG - Intergenic
1035987337 8:4449347-4449369 CATTCTGGAAAAAAAGAGAGGGG - Intronic
1036260387 8:7235370-7235392 CTTCATGAAAAAAAAGGTAAAGG + Intergenic
1036312424 8:7693926-7693948 CTTCATGAAAAAAAAGGTAAAGG + Intergenic
1036659664 8:10699889-10699911 CTCTAGGCAAGAAAAGAAAAGGG + Intronic
1038053648 8:23837325-23837347 CATTATTTAAAAAATGAGAAGGG + Intergenic
1038573953 8:28687751-28687773 CTTAATGAAAGAAAAGAGAAAGG + Intronic
1038689898 8:29751790-29751812 CTTTTTTTAAAAAAAAAGAAAGG + Intergenic
1040440708 8:47438684-47438706 CTTAAGGCAAGAAAACAGAATGG - Intronic
1040691947 8:49949436-49949458 CTATAAGAAAAAAAAGAGAGTGG - Intronic
1040976589 8:53199980-53200002 CTTACCGCAAAGAAAGAGAAAGG + Intergenic
1041208363 8:55521894-55521916 TTATATCCAAAAGAAGAGAAAGG + Intronic
1041226380 8:55702985-55703007 ATTAATGCAAAACAAGACAACGG + Intronic
1041693569 8:60713941-60713963 CTTTCTACAAAGAAAGAAAACGG - Intronic
1042126142 8:65539114-65539136 CTTAATGAAAGAAAAGAAAATGG + Intergenic
1042208376 8:66351944-66351966 CTTTATAGAAGAGAAGAGAAGGG - Intergenic
1042899560 8:73709678-73709700 ATTTATTTAAAAAAACAGAAAGG - Intronic
1043377222 8:79664174-79664196 CTTTATGGAGAAAAGGACAATGG + Intronic
1043708503 8:83382423-83382445 CTGAAAGCAAAAAAAGGGAAAGG + Intergenic
1044003964 8:86919025-86919047 TTTTTTAAAAAAAAAGAGAAAGG + Intronic
1044270725 8:90240011-90240033 CTATATGAAAAAAAAGTTAATGG + Intergenic
1044437916 8:92187846-92187868 GTGTATGAAAAAAAAGAGGAGGG - Intergenic
1044704813 8:94998486-94998508 CTTTATGTAATGAAATAGAATGG - Intronic
1044777368 8:95704948-95704970 TTTTATGGAAAGTAAGAGAAAGG + Intergenic
1045280148 8:100743034-100743056 CTTTAAAAAAAAAAAAAGAATGG - Intergenic
1045797131 8:106059357-106059379 CTTTTTGCCAAAAAACAGATAGG + Intergenic
1046847322 8:118932457-118932479 AATTATGTAAAAAATGAGAATGG - Intronic
1047188927 8:122660563-122660585 CTTTATGAAAAAAAAAAAGAGGG - Intergenic
1047299518 8:123600999-123601021 CTTTATGGAAAATAATAGAGGGG + Intergenic
1047541092 8:125767547-125767569 CTTGATTCAGTAAAAGAGAAGGG + Intergenic
1047700826 8:127447900-127447922 CTTTTTGGAAAAAAAGGCAAAGG - Intergenic
1047990226 8:130278569-130278591 CATCAAGGAAAAAAAGAGAAAGG - Intronic
1048730755 8:137438120-137438142 CTTTAAAAAAAAAAATAGAATGG - Intergenic
1048819463 8:138367128-138367150 CGTTATGCAACAAAAGCAAATGG + Intronic
1049114602 8:140675059-140675081 CTGTATCCAAAAAAAAAAAAAGG + Intronic
1049908174 9:238614-238636 CTTTATGTAAAACAACATAAAGG + Intronic
1050066192 9:1761872-1761894 ATTTATGGAAGCAAAGAGAACGG - Intergenic
1050164585 9:2750874-2750896 CTTCCTTCAAAGAAAGAGAAGGG + Intronic
1050225342 9:3448517-3448539 CTTTAAAAAAAAATAGAGAAGGG + Intronic
1050455061 9:5826807-5826829 CTTTATTCAAAAAGAGAGAAAGG + Intronic
1050641159 9:7669022-7669044 GCTTATGCATAAAAAGAAAAAGG - Intergenic
1050658579 9:7857248-7857270 CTTTATAGAACAAAAGAGAATGG - Intronic
1050757030 9:9017253-9017275 CTTTATGCCAATGAAAAGAAAGG + Intronic
1050795987 9:9542310-9542332 CTTAATGCCAAAAAAGATCATGG + Intronic
1051222676 9:14866862-14866884 CTGTCTGAAAAAAAAAAGAAAGG - Intronic
1051724381 9:20073687-20073709 CTTTATGGAAAAAATGGAAATGG - Intergenic
1051755101 9:20390939-20390961 CTTTTTTCAAAAAATGAGATGGG - Intronic
1051855219 9:21558264-21558286 AGTTAAGGAAAAAAAGAGAAAGG + Intergenic
1051986922 9:23100699-23100721 CTTTATGGAAGGAAAAAGAATGG + Intergenic
1052090990 9:24327233-24327255 GTTTATATAAAAAAAGAGACAGG + Intergenic
1052114291 9:24630383-24630405 CTTTATTCAAAAAAAGTAATTGG + Intergenic
1052199096 9:25756438-25756460 CTTTATGAATAAAAAAAAAAGGG - Intergenic
1052538974 9:29782067-29782089 CTTATTACAGAAAAAGAGAATGG - Intergenic
1054845476 9:69792322-69792344 CCATCTGCAAACAAAGAGAAAGG - Intergenic
1054992710 9:71348455-71348477 CTATCTGCAAAAAAAAAAAATGG - Intronic
1055043915 9:71905707-71905729 CTTTATGCAAGAAAAGTGCCTGG - Intronic
1055113297 9:72580989-72581011 CTTTCTGCAAATATAGAGAGAGG - Intronic
1055857876 9:80713472-80713494 CTATAAGCAGAAAAAGAGCACGG - Intergenic
1056376879 9:86023372-86023394 CTTTAAACAAAAAAAGGCAAAGG + Intergenic
1057585124 9:96322077-96322099 CATTCTGCAGAAAAAGAGAGAGG + Exonic
1058533146 9:105926985-105927007 CTTTTTTCAAAAAAAAAAAAAGG - Intergenic
1058711987 9:107687090-107687112 CTTTATGCTCAAAAAGTGATTGG - Intergenic
1058829485 9:108802511-108802533 ATTTTTTCAAAAAAAGACAATGG + Intergenic
1058834887 9:108852181-108852203 CTCAGTGCAAATAAAGAGAATGG - Intergenic
1059576680 9:115496875-115496897 CTTTATCTACAAAATGAGAAGGG - Intergenic
1059671256 9:116494495-116494517 CTTTTTGCAAAAAAACAGGAAGG - Intronic
1059903922 9:118960564-118960586 CATTATGCAAAGAAAAAGAGAGG - Intergenic
1059912339 9:119059052-119059074 TTTTATGATAGAAAAGAGAATGG - Intergenic
1060118006 9:120960473-120960495 CTTTATGAAAGAAAAGAAAATGG - Intronic
1060567459 9:124605960-124605982 GGTGATGCAGAAAAAGAGAAAGG - Intronic
1062110959 9:134781919-134781941 CTTGATCCAAAAAGAGTGAAAGG - Intronic
1062496666 9:136835095-136835117 CTCTATTTAAAAAAAGAGAAGGG + Intronic
1062750909 9:138252666-138252688 CTATAAGAAAAAAAAGAAAAAGG - Intergenic
1203749999 Un_GL000218v1:69351-69373 CTATATGAAATAAAAGATAAAGG + Intergenic
1203483973 Un_GL000224v1:34910-34932 CTATATGAAATAAAAGATAAAGG - Intergenic
1203708714 Un_KI270742v1:75560-75582 CTATATGAAATAAAAGATAAAGG + Intergenic
1203542369 Un_KI270743v1:101920-101942 CTATATGAAATAAAAGATAAAGG - Intergenic
1185993530 X:4918045-4918067 CTGTATGGAAAGAAAGAGATAGG - Intergenic
1186296259 X:8152058-8152080 CTTTAAAAAAAAAAAAAGAAAGG - Intergenic
1186366859 X:8904580-8904602 CTTTTTCCAGAAACAGAGAAGGG - Intergenic
1186482653 X:9907769-9907791 CTTTATTTAAAAAAACAGACAGG - Intronic
1186548842 X:10480977-10480999 ATTTATTCAAAGAAAGAGAAAGG - Intronic
1186559627 X:10597560-10597582 CTTTGTGCATAAAAAGAGTAAGG - Intronic
1186903309 X:14082755-14082777 CATTATACTAAAAAAGAAAATGG - Intergenic
1187067180 X:15852873-15852895 CTATATGCATCAAAAGAGAATGG + Intronic
1187195811 X:17082393-17082415 CTTACTGCAAAAAAGGAGAAGGG + Intronic
1187537236 X:20153428-20153450 CTCTATGCAATTAAAGAGAAAGG - Exonic
1188360785 X:29250658-29250680 CTTTCTGCAAGGAAAAAGAAGGG + Intronic
1188401287 X:29748189-29748211 TTTTATGGAAAAAAGGAAAAAGG - Intronic
1188594952 X:31888514-31888536 TTTTATCCAAAAGAAGATAATGG - Intronic
1189296288 X:39920605-39920627 ATATATGCAAAAAAAAAAAAAGG + Intergenic
1189519819 X:41754393-41754415 CCTGACTCAAAAAAAGAGAAGGG + Intronic
1189554784 X:42130804-42130826 ATTAATGCAAAAGAACAGAACGG + Intergenic
1189648994 X:43168549-43168571 CTTTATGGAAAAAAAAAAAAAGG - Intergenic
1189975145 X:46453898-46453920 CTTTCAGGAAAAAAAGAGAAAGG - Intronic
1190482600 X:50892098-50892120 CATTCTGCAAAGAAATAGAAAGG + Intergenic
1191594634 X:62929497-62929519 CTATATGTAAAATAAGTGAAGGG + Intergenic
1191795360 X:65016138-65016160 CTTTTTGGCAAAAAAGAAAAGGG - Intronic
1191905624 X:66085745-66085767 CTTTATGCAAAAGATTAGACTGG - Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1192337992 X:70237913-70237935 CTTAATGAAAAAAAAAAAAAAGG + Intronic
1193017073 X:76746794-76746816 CATTATACGAAAAAAGATAATGG + Intergenic
1193246365 X:79235084-79235106 CTTTTTGCAAAAACAAACAAAGG + Intergenic
1193280084 X:79637979-79638001 TTTTTTGAAAAAAATGAGAATGG - Intergenic
1193640606 X:84006300-84006322 TTGTGTACAAAAAAAGAGAAAGG - Intergenic
1193660413 X:84250068-84250090 CTTTATGCAAAGGAAGTAAAAGG - Intergenic
1193747424 X:85298978-85299000 CTCTATGCCATAAAAGAAAAAGG + Intronic
1193822129 X:86178312-86178334 ATTTATACAAAAAAAGAGATAGG - Intronic
1193830746 X:86286620-86286642 CTTAAAGCAAAAAAATACAAGGG - Intronic
1194312832 X:92335121-92335143 CTTCATGCTAAAAAAGGAAAAGG - Intronic
1194492105 X:94564626-94564648 CTTTATACAAATGAAGATAAAGG - Intergenic
1194940709 X:100006513-100006535 CTTTATTAAAAAAAAAAAAAAGG + Intergenic
1195038261 X:100990034-100990056 ACTTATGGCAAAAAAGAGAATGG + Intronic
1195429771 X:104775852-104775874 GTTTATGAAAAAAAAAAGAGAGG + Intronic
1196750656 X:119114631-119114653 CTTTTTGCAGAAAAAGTGAGAGG + Intronic
1197311730 X:124913603-124913625 CTTTATGTAACACAAGAGACTGG + Intronic
1197921356 X:131597916-131597938 CTTTTTGGAAAAAATGTGAACGG + Intergenic
1198025549 X:132702820-132702842 CTTTAAGAAACACAAGAGAAGGG + Intronic
1198156287 X:133964007-133964029 CTTCATGGAAACAGAGAGAAAGG - Intronic
1198380893 X:136082386-136082408 AATTATGCAAAAATAGAGATGGG + Intergenic
1198999815 X:142621825-142621847 CTAAAGGCAAAAAAAGAGAAGGG + Intergenic
1200621100 Y:5449260-5449282 CTTCATGCTAAAAAAGGAAAAGG - Intronic
1201163651 Y:11186993-11187015 CTATATGAAATAAAAGATAAAGG + Intergenic
1201677167 Y:16598870-16598892 TTTTCTGCAAAGAAAAAGAATGG - Intergenic
1201777210 Y:17679244-17679266 CTTCATGCATATGAAGAGAAAGG - Intergenic
1201824347 Y:18226748-18226770 CTTCATGCATATGAAGAGAAAGG + Intergenic
1201991155 Y:20028099-20028121 AATTATGCAAAAAATGAGACTGG - Intergenic
1202013705 Y:20377552-20377574 CTTTATGCAAACAATGTCAATGG - Intergenic