ID: 961557521

View in Genome Browser
Species Human (GRCh38)
Location 3:127706809-127706831
Sequence CCGTGGAAGGCTGTGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961557511_961557521 21 Left 961557511 3:127706765-127706787 CCGAGTTTGCTGGAAGGTTCTTA 0: 1
1: 0
2: 0
3: 21
4: 210
Right 961557521 3:127706809-127706831 CCGTGGAAGGCTGTGTCCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 227
961557510_961557521 26 Left 961557510 3:127706760-127706782 CCAAACCGAGTTTGCTGGAAGGT 0: 1
1: 0
2: 0
3: 3
4: 40
Right 961557521 3:127706809-127706831 CCGTGGAAGGCTGTGTCCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961557521 Original CRISPR CCGTGGAAGGCTGTGTCCTG GGG Intronic
900137293 1:1123061-1123083 GCGGAGAAGGCTGTGCCCTGAGG - Intergenic
900823869 1:4910910-4910932 GCCTGGCAGGCTCTGTCCTGTGG + Intergenic
900911231 1:5598377-5598399 CCGTGGGAGGCTCTGCACTGAGG - Intergenic
900964876 1:5950956-5950978 CCGTGGGAGGCTGTCTGCAGTGG - Intronic
900979981 1:6040757-6040779 CCGTGGAAGGCAGAAGCCTGTGG - Intronic
901668133 1:10838100-10838122 CCGGGCTAGGCTGGGTCCTGGGG - Intergenic
902255383 1:15185845-15185867 ACGTGGAATGCTGTAGCCTGTGG + Intronic
902280321 1:15369669-15369691 CCGTGGACAGCTGTGACCTCTGG - Intronic
903336461 1:22627668-22627690 CCATGGAAGGCTGCCTTCTGGGG - Intergenic
903554900 1:24186389-24186411 CCGAGGATGGCTGGGTCGTGAGG + Intronic
903683706 1:25115285-25115307 ACGTGGTTGGCTGTTTCCTGGGG - Intergenic
905913355 1:41668924-41668946 ACCTGGAAGGCTTTCTCCTGAGG + Intronic
907242064 1:53086362-53086384 CAGTGGGAGGAGGTGTCCTGGGG + Intergenic
907723223 1:56993593-56993615 CTTTGGAAGGCTGAGGCCTGTGG + Intergenic
908662103 1:66447931-66447953 CCCTGCAAAGCTGTCTCCTGTGG + Intergenic
912589217 1:110797921-110797943 CTGTGGAAGATTCTGTCCTGTGG + Intergenic
912779995 1:112537240-112537262 CTTTGGAAGGCTGAGGCCTGCGG - Intronic
914226909 1:145728215-145728237 CCCTGGAAGGCTTTGTCTAGTGG + Intronic
917152924 1:171964143-171964165 CCCTGCAAAGCTGTCTCCTGTGG + Intronic
917257018 1:173126412-173126434 CCCTGGAAAGCTGTCTCTTGTGG - Intergenic
922717287 1:227884296-227884318 CCGTAGTATGCTGTGTCGTGAGG + Intergenic
924654590 1:245962067-245962089 ACGTGGGAGGCTGTGTCATGTGG - Intronic
924727999 1:246687676-246687698 CCGTTGAGGGCTGTGTGGTGAGG + Intergenic
924738887 1:246783082-246783104 TTCTGGAAGGCTGTGGCCTGGGG - Intergenic
1062858611 10:792513-792535 CCGTGGATGGCCCAGTCCTGAGG - Intergenic
1063276240 10:4571071-4571093 CCTGGGAAGGCTGTATCCTTGGG + Intergenic
1064184842 10:13152673-13152695 CCCTGCAAAGCTGTCTCCTGTGG + Intergenic
1065184368 10:23157709-23157731 CCGGGGAGGGCAGAGTCCTGGGG + Intergenic
1065429840 10:25642106-25642128 CTGTGGGAGGCTGAGTCTTGAGG + Intergenic
1065630177 10:27671786-27671808 CCTTGGAAGGCGGTGTGTTGTGG - Intergenic
1069546679 10:69334233-69334255 CCGGGCAAGGCTGTGTCCCCAGG + Intronic
1071052938 10:81473421-81473443 CCGGGGAAGGCTGAATCCTGTGG + Intergenic
1074028485 10:109661677-109661699 CCGTGGCATGCTGTGGCCTGTGG + Intergenic
1074673825 10:115826103-115826125 CCTTGGAGAGCTGTTTCCTGGGG + Intronic
1076124333 10:127962463-127962485 CCGGGGAGGTCTGTGTCCAGCGG - Intronic
1076629405 10:131843169-131843191 CCCTGGCTGGCTGTGACCTGTGG - Intergenic
1076734226 10:132451617-132451639 CCCTGGAATGCTGTGTTTTGGGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077242744 11:1519293-1519315 CAGTGGATGGATGTGTGCTGGGG - Intergenic
1077390691 11:2299485-2299507 CTCTGGAAAGCTGTGTCCTCGGG - Exonic
1077778471 11:5297904-5297926 GCGTGGGAGGGTGTTTCCTGAGG + Intronic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078613113 11:12839536-12839558 AGGTGCTAGGCTGTGTCCTGGGG + Intronic
1078654229 11:13223203-13223225 CCCAGGAAGGCTGTGAACTGAGG + Intergenic
1079022691 11:16922879-16922901 CAGTGGAGGCCTCTGTCCTGGGG - Intronic
1080988835 11:37505804-37505826 CCCTGCAAAGCTGTCTCCTGTGG + Intergenic
1083751666 11:64764279-64764301 CCTTTGAAGGCTTTTTCCTGGGG - Intergenic
1084350280 11:68592941-68592963 TCAGGGAAGACTGTGTCCTGGGG + Intronic
1084714609 11:70865675-70865697 CGGTGCGAGGCAGTGTCCTGTGG - Intronic
1086127603 11:83365331-83365353 CCCTGCAAAGCTGTCTCCTGTGG - Intergenic
1086390401 11:86357477-86357499 CCCTGCAAAGCTGTCTCCTGTGG + Intergenic
1087277409 11:96174307-96174329 CCATAGATGGCAGTGTCCTGGGG - Intronic
1087935303 11:104026789-104026811 CCTTTGAAGGAAGTGTCCTGTGG + Intronic
1088990069 11:114945935-114945957 CATTGTAAAGCTGTGTCCTGTGG - Intergenic
1089340030 11:117750970-117750992 CCTGGGAAGACTGTGACCTGGGG - Intronic
1090395524 11:126415691-126415713 GTCTTGAAGGCTGTGTCCTGGGG + Intronic
1091386151 12:96479-96501 CCCTGGAAAGCTGTCTCTTGTGG - Intronic
1092282350 12:7108073-7108095 TGGTGGGAGGCTGTGTCCTGGGG + Intronic
1093186130 12:16021629-16021651 CCTTGGAAAGCTCTGCCCTGTGG - Intronic
1094359354 12:29613300-29613322 CAGTGGGAGGCTGTGGCCTGAGG + Intronic
1095145934 12:38726109-38726131 CTGTACTAGGCTGTGTCCTGAGG + Intronic
1095348961 12:41187716-41187738 CCTAAGAAGGCAGTGTCCTGAGG + Intergenic
1096156131 12:49342441-49342463 CAGTGGAGGACTGTGGCCTGAGG + Intergenic
1096623204 12:52877417-52877439 ACGTGCAGGGCTGTGTGCTGTGG - Intergenic
1099076661 12:78118135-78118157 AAGTGGAAGACTGTGTCCTCTGG + Exonic
1102444388 12:112990624-112990646 CCCTGCAAAGCTGTGTCCTGTGG - Intronic
1104539013 12:129645064-129645086 CCTTGCAAGGCTGTCTTCTGTGG + Intronic
1104959416 12:132481108-132481130 CAGTGGAAGGCTGGGTGCAGTGG + Intergenic
1105479220 13:20758050-20758072 CCCTGCAAAGCTGTCTCCTGTGG + Intronic
1106455073 13:29919745-29919767 ACGTGGAAGGCTGTGGCAGGAGG + Intergenic
1113530825 13:111024925-111024947 CCTTTGATGGCTGTGTCCTGTGG - Intergenic
1113933677 13:113981944-113981966 CGTTGGAAGGATGTGTACTGTGG - Intronic
1118301305 14:64618897-64618919 CTGAGGAAGGCAGTGTCGTGTGG - Intergenic
1118631323 14:67706382-67706404 CCTCCGAAGGCTGTGTCGTGGGG - Intronic
1120683393 14:87508105-87508127 ACCTGGAATGCTGTGTCCTCTGG - Intergenic
1121896163 14:97649911-97649933 CCTTGGAAGTCTGTGTCATGTGG + Intergenic
1122403093 14:101479030-101479052 CTGAGGGAGGCTGTGGCCTGTGG - Intergenic
1122599129 14:102912572-102912594 ACCAGCAAGGCTGTGTCCTGGGG - Intergenic
1123918290 15:25053130-25053152 GGGAGGAAGGCTGTGTCTTGAGG + Intergenic
1124005899 15:25795267-25795289 ACGTGGACGGTGGTGTCCTGTGG - Intronic
1128216335 15:65936798-65936820 CCCTGGTAGGCTGGGTTCTGTGG + Intronic
1128301399 15:66568265-66568287 CCAGGCAAGGCTGTGTCCTCAGG + Intergenic
1130077287 15:80700137-80700159 CCCTGGAAGGATGTGTGTTGAGG - Intronic
1130684643 15:86026014-86026036 CTGTGGAAAGCTGGGTGCTGTGG + Intergenic
1133989741 16:10695322-10695344 CCTTGGAAGGCTGTGGCCAGAGG + Intergenic
1134539598 16:15054277-15054299 CCTAGAAAGGCTGTGTACTGGGG - Intronic
1135197891 16:20409554-20409576 CTGTGGGAGGCTGTTTTCTGAGG + Exonic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1138624240 16:58236611-58236633 CCCTGGGAGGCTGGTTCCTGTGG - Intronic
1139225349 16:65229118-65229140 CCTTGGAAGGCTGGGGCCTATGG + Intergenic
1140871277 16:79108790-79108812 ACTTGGGAGGCTGTGGCCTGAGG + Intronic
1141583301 16:85015513-85015535 CCCTGCAAAGCTGTCTCCTGTGG - Intergenic
1141623313 16:85248582-85248604 AAGTGGAAGGCAGAGTCCTGGGG + Intergenic
1141759668 16:86019661-86019683 GCCTGGAAGGCGCTGTCCTGGGG - Intergenic
1141795264 16:86268700-86268722 CCTTGAAAGGCTGTTTGCTGGGG - Intergenic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142373148 16:89694093-89694115 CTCGGGGAGGCTGTGTCCTGTGG + Intronic
1142528786 17:564600-564622 ACTTGGAAGGCTGAGACCTGAGG + Intronic
1144123255 17:12177523-12177545 CTTTGGAAGGCTGAGGCCTGTGG - Intergenic
1144444056 17:15309922-15309944 CAGTGCAAGGCTTTGTCCTTGGG + Intronic
1145962197 17:28893341-28893363 GAGTGGTGGGCTGTGTCCTGGGG - Intronic
1146670381 17:34733466-34733488 CCCTGGGAGGCTGTGACCAGGGG + Intergenic
1146945398 17:36869950-36869972 TAGGAGAAGGCTGTGTCCTGAGG - Intergenic
1147201086 17:38801808-38801830 CTCTGGAAGGCTGTTCCCTGGGG - Exonic
1150031810 17:61745610-61745632 CTGTGGAAGGCTGAGTCTGGAGG - Intronic
1151619554 17:75237625-75237647 CAGTGGCAGGCTGTGTCCTATGG - Exonic
1151667248 17:75552243-75552265 CTCTGGAAGGCTGAGGCCTGTGG + Intronic
1152813457 17:82393197-82393219 CGGTCGATGGCTGTGTCCAGCGG - Intronic
1152853226 17:82649302-82649324 CCTGGGAGTGCTGTGTCCTGGGG - Intergenic
1152942267 17:83178860-83178882 CCGTGGAACCCTGAGGCCTGGGG - Intergenic
1156858539 18:41811305-41811327 CCAATGAAGGCTGTGGCCTGAGG + Intergenic
1157391551 18:47307492-47307514 CCTTGGAAGGATGTGACTTGGGG + Intergenic
1157484142 18:48075099-48075121 ACATGGAAGTCTGTATCCTGGGG - Intronic
1157551520 18:48585074-48585096 CCTTGGAAGGGTGAGGCCTGCGG + Intronic
1161116847 19:2501993-2502015 CCTTGGAGGTCTGTGTTCTGTGG + Intergenic
1161277441 19:3426575-3426597 CCGTGGATGGCTGTGCGCAGAGG - Intronic
1161524036 19:4742630-4742652 CCCTGCAGGGCTGTGTCCAGGGG + Intergenic
1162248911 19:9426103-9426125 CAATGGAAGGCAGTGTCCTGGGG - Intronic
1162687721 19:12401130-12401152 CCGTGGCAGCCTGTGTCCCGCGG - Exonic
1162752870 19:12839161-12839183 CAGTGTAAGGCTGTGTTCGGGGG - Intronic
1162873101 19:13600498-13600520 ACGTGGAAGGCTGGGTGCAGTGG + Intronic
1164446806 19:28324674-28324696 CCCTGCAAAGCTGTCTCCTGTGG + Intergenic
1165150559 19:33757895-33757917 CTCTGGAAGGCTCTGGCCTGAGG - Intronic
1166851085 19:45761673-45761695 GCCTTGGAGGCTGTGTCCTGGGG - Exonic
1167357689 19:49014308-49014330 CTGTGGAAGGCTGCGTCATCAGG + Intronic
1167925952 19:52821184-52821206 CCCGGGAAGGCTGCGTTCTGTGG - Intronic
1167930138 19:52857170-52857192 CCCGGGAAGGCTGCGTTCTGTGG - Intronic
925348551 2:3186584-3186606 CGGTGGATGGATGTGGCCTGGGG - Intergenic
926052505 2:9753903-9753925 CCGTGGGAGGGTGAGTTCTGAGG + Intergenic
926337700 2:11876644-11876666 CCGTGCCAGGGGGTGTCCTGAGG - Intergenic
927588878 2:24335619-24335641 CCCTGGAAGGCTGGGTGCAGTGG - Intronic
929600242 2:43200057-43200079 AGCTGGAGGGCTGTGTCCTGTGG + Intergenic
930118355 2:47739356-47739378 CCTTGCAAAGCTGTCTCCTGTGG + Intronic
932722626 2:74148701-74148723 CTCTGTTAGGCTGTGTCCTGTGG - Intergenic
934525571 2:95049575-95049597 CAGTGGTAGGCTGCGTCCTATGG - Exonic
935223053 2:101031397-101031419 CCCTTGAAGACTGTGTCCTAAGG - Intronic
935353291 2:102174305-102174327 CTGTGGAATGCTCTATCCTGTGG + Intronic
935693289 2:105748935-105748957 CTGTGGAAGGCTTTGACCTCAGG + Intronic
938070582 2:128306238-128306260 CCAGGGAAGGCACTGTCCTGTGG - Intronic
941309446 2:163911009-163911031 ACGTAAAAGGCTGCGTCCTGTGG - Intergenic
941321696 2:164063441-164063463 CCGTGGAAGAATTTGTCCTTTGG - Intergenic
941715305 2:168757227-168757249 CCAGGCAAGGCTGTGTCCTTCGG - Intronic
945304649 2:208247542-208247564 ACTTGGAAGGCTGAGGCCTGAGG - Intronic
946194455 2:218024737-218024759 GTGTAGAAGGCTGTGTCCAGGGG + Intergenic
948321106 2:237070449-237070471 CCCTGGAAAGCTGTCTCATGTGG + Intergenic
948613671 2:239185013-239185035 CCCTGGAGGGCTGTGCCCTATGG + Intronic
949042708 2:241856884-241856906 CCTGGCAAGGCTGCGTCCTGAGG - Intronic
1170607349 20:17883913-17883935 CCCTGGAAGGCTGAGCCCTAGGG + Intergenic
1171066215 20:22018007-22018029 CCCGGGAAGGCTGTGGCATGAGG + Intergenic
1171180848 20:23089204-23089226 TCCTGGAAGGCTGTGTCCGCTGG + Intergenic
1171371330 20:24664169-24664191 CTCTGGAAGTCTGTGTCGTGTGG - Intronic
1173120927 20:40288195-40288217 TCATGGAAGGGTCTGTCCTGGGG - Intergenic
1173821753 20:46024112-46024134 GCCTGGAATGCTGTGTGCTGTGG + Intronic
1174110969 20:48197528-48197550 CACTGGAAGGCTGGGTCCTGAGG + Intergenic
1175269118 20:57721354-57721376 GGGTGGCAGGCTGGGTCCTGTGG - Intergenic
1175667528 20:60873082-60873104 CCATGGAAGGCAGTGCCATGGGG - Intergenic
1175768191 20:61605753-61605775 CCGTGAGAAGCTGTGACCTGTGG + Intronic
1177515719 21:22148586-22148608 CCTTGGACAGCTCTGTCCTGTGG - Intergenic
1178405603 21:32320823-32320845 CTGTGGAAGTCTGTGTCCTCTGG - Intronic
1179787830 21:43739930-43739952 CCGGTGGAGGGTGTGTCCTGAGG - Intronic
1179795259 21:43778764-43778786 CTGAGGGAGGCTGTGGCCTGGGG + Intergenic
1179939067 21:44626737-44626759 CAGAGGAAGCCCGTGTCCTGAGG + Intronic
1181368032 22:22394847-22394869 CCCAGGGAGGCTGTGTGCTGTGG - Intergenic
1181431653 22:22885139-22885161 CCATGGAAGGATGTGGTCTGCGG + Intronic
1184098463 22:42329265-42329287 CCTTGGCAGCCTGTGTGCTGGGG - Intronic
1184658914 22:45956405-45956427 CCGGGGGAGGCTGGATCCTGGGG - Intronic
949741390 3:7238556-7238578 CCTTTCAAGGCTGTGTCCTCAGG + Intronic
953957016 3:47239474-47239496 CCGTGGAGGGCTTTGCCCTCAGG + Intronic
955523207 3:59795140-59795162 CCGTGGGAGGCTGAGGCATGCGG + Intronic
956698358 3:71937513-71937535 CCGTGGACGGCAGGGACCTGTGG - Intergenic
957293989 3:78312439-78312461 CTCTGGAAGGCTGAGGCCTGAGG + Intergenic
961557521 3:127706809-127706831 CCGTGGAAGGCTGTGTCCTGGGG + Intronic
961651922 3:128421071-128421093 GCGTGGCAGGCTTTGTCCTGTGG + Intergenic
962986447 3:140540593-140540615 CTGTGTATGGCTGTTTCCTGGGG - Intronic
966349593 3:179017486-179017508 CTTTGGAAGTCTGTGTTCTGGGG - Exonic
968190080 3:196661046-196661068 CTCTGGAGGGCTGTGGCCTGGGG + Exonic
968427199 4:531962-531984 CCAGGGAGGGCTGGGTCCTGGGG - Intronic
968470699 4:781198-781220 CCGGGAAAGGCTGTGGCCTGGGG - Intergenic
968713370 4:2137030-2137052 CCCCGGGAGGCTGTGTCCAGAGG - Intronic
969696667 4:8738793-8738815 CTGTGGAGGGCTGGGCCCTGGGG + Intergenic
972316415 4:37930672-37930694 CCTTGAAATGCTGTGTTCTGTGG + Intronic
977450377 4:97188686-97188708 CCCTTGAAGGCTTTGTCCTTTGG - Intronic
980233474 4:130073744-130073766 CCCCCGAATGCTGTGTCCTGGGG - Intergenic
982944689 4:161605283-161605305 CTGTGGAAGGCTATGTGCTATGG - Intronic
991223281 5:64240734-64240756 GCCTGGAAGGCTCTGCCCTGAGG + Intronic
992364552 5:76078573-76078595 CCGTGTCAGGCTGTGGCCCGCGG - Intergenic
993106982 5:83610804-83610826 CCTAGGAAGGATGTGTCCTTGGG - Intergenic
994619103 5:102141783-102141805 GAGTAGAAGGCTGTTTCCTGGGG - Intergenic
1000280678 5:159779111-159779133 ACTTGGAAGGCTGAGTCATGAGG + Intergenic
1001405926 5:171477566-171477588 GGGTGGAAAGTTGTGTCCTGGGG + Intergenic
1001550127 5:172596552-172596574 CGCTGGAAGGATCTGTCCTGGGG + Intergenic
1002423764 5:179164089-179164111 CAGTGGCAGGTTGAGTCCTGGGG - Intronic
1004307101 6:14510828-14510850 CCGTGGAGTGCTGGGTTCTGTGG - Intergenic
1004441864 6:15662323-15662345 GCGCGGAAGGCTGTGGCCGGAGG + Intronic
1005874289 6:29999431-29999453 TGGTGGAAGGTTGTGTCCTCTGG - Intergenic
1005882404 6:30071380-30071402 CTGCGTAAGGCTGTGCCCTGCGG - Exonic
1006341965 6:33452152-33452174 ACGGGGTAGGCGGTGTCCTGGGG - Exonic
1007056178 6:38887596-38887618 GCGTGGAAGGCTGAGGCCAGAGG + Intronic
1010204064 6:73307652-73307674 CCGTTTAAGGCTGGGGCCTGAGG - Intronic
1014720985 6:124917980-124918002 CCAGGGAAGGCTGTTTTCTGGGG + Intergenic
1016022863 6:139254493-139254515 CAGTGGAAGTCTGTGGCCTGTGG + Intronic
1016352024 6:143178358-143178380 CTGTGGCAGCCTGTGTCCTGCGG + Intronic
1016990130 6:149922864-149922886 CCGTGGGGGGCTGTGGACTGTGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018595726 6:165478637-165478659 CCCTGCAAAGCTGTCTCCTGGGG + Intronic
1018954218 6:168397197-168397219 CCGTGGGCGGCTGAGCCCTGAGG - Intergenic
1019048114 6:169163387-169163409 CCTTGCAGGGCTGTGTCCTGTGG + Intergenic
1019256765 7:57349-57371 CCATGGCAGGCTGGGTGCTGGGG + Intergenic
1019341122 7:509531-509553 CCGTGGAAGGCTGAGGCTGGAGG - Intronic
1019411223 7:907639-907661 CTCTGGAACTCTGTGTCCTGCGG + Intronic
1020278412 7:6637805-6637827 TCCTGGATGGGTGTGTCCTGGGG - Intronic
1024212213 7:47215774-47215796 CCGTGGACAGCTGAGGCCTGAGG + Intergenic
1024836470 7:53525649-53525671 TCATGGAAGGCTGCTTCCTGAGG + Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1027856609 7:83519880-83519902 CCTTGAAAGTCTGTGTCCTTGGG - Intronic
1028800377 7:94957375-94957397 TCTTGGAAGACTGTGTCCTAAGG + Intronic
1029317820 7:99730395-99730417 CCTTTGAAGGCTGCGTCTTGTGG - Intronic
1032262389 7:130347699-130347721 CCCTGGAAGGCTGTGTCACTTGG - Intronic
1034559592 7:151871593-151871615 CGGTTGATGGCTGTGTACTGGGG - Intronic
1035319538 7:158019881-158019903 CAGTGGAAAACCGTGTCCTGCGG - Intronic
1037813083 8:22098119-22098141 CCGTGGCTGGTTGTGTCCTTAGG - Exonic
1037910897 8:22743039-22743061 CGGTGAAGGGCTGTGTGCTGGGG + Intronic
1040598928 8:48865496-48865518 CCCTGGAAGGCAGAGGCCTGAGG + Intergenic
1046866717 8:119159221-119159243 CCCTGCAAAGCTGTGTCTTGTGG - Intergenic
1049412871 8:142481248-142481270 CCGTCGCAGGATGAGTCCTGGGG - Exonic
1049429454 8:142552821-142552843 CCCTGCAAGGCTGTCTCTTGTGG - Intergenic
1049959922 9:728521-728543 CCCTGCAAGGCTGTCTCTTGTGG + Intronic
1050939591 9:11442081-11442103 CCGTGGAAGGTTATTTCCTCTGG - Intergenic
1057981537 9:99668855-99668877 CCCTGTAAAGCTGTCTCCTGTGG - Intergenic
1059417817 9:114172877-114172899 CAGTGGAAGACTGAGCCCTGGGG - Intronic
1059525259 9:114985376-114985398 AGGTGGAAGGCTGAGTCCTTGGG + Intergenic
1060148136 9:121268962-121268984 CCTTGGAAGGCTGGGGGCTGGGG + Intronic
1061190253 9:129078682-129078704 CAGTGTAAGCCAGTGTCCTGGGG - Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061829972 9:133285500-133285522 CCGTCGAATGATGTGGCCTGTGG + Intergenic
1061831955 9:133301825-133301847 CCGTCGAATGATGTGGCCTGTGG - Intergenic
1062361406 9:136190072-136190094 CCCTGGAAGGGTGTGGCCGGAGG - Intergenic
1062660166 9:137626690-137626712 CCATGGAAAGCTGAGTGCTGGGG + Intronic
1186753595 X:12647083-12647105 CAGAGGAAATCTGTGTCCTGAGG - Intronic
1187018687 X:15357332-15357354 CCATGGAGGGCAGCGTCCTGGGG - Intronic
1187412282 X:19061955-19061977 CTGCTGAAGGCTGTGTCCAGTGG + Intronic
1192397863 X:70801460-70801482 TCCTGGAAGGCAGTGTCATGTGG - Intronic
1192436983 X:71148973-71148995 TGGAGGAAGGCTGGGTCCTGGGG - Intronic
1194192760 X:90857735-90857757 ATGTGGAAAGCAGTGTCCTGAGG - Intergenic
1196806856 X:119595842-119595864 CTTTGGAAGGCTGAGGCCTGCGG - Intronic
1198727417 X:139692079-139692101 CCGTGGACCTCAGTGTCCTGCGG - Intronic
1198827468 X:140714270-140714292 CTGGGCAAGTCTGTGTCCTGAGG - Intergenic
1200161666 X:154012878-154012900 CCTGGGAAGGATGTGGCCTGGGG + Intronic
1200539388 Y:4440184-4440206 ATGTGGAAAGCAGTGTCCTGAGG - Intergenic