ID: 961557861

View in Genome Browser
Species Human (GRCh38)
Location 3:127708872-127708894
Sequence CCAGCAATCAATTGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961557859_961557861 -7 Left 961557859 3:127708856-127708878 CCATGGGCTGCGTGGACCAGCAA 0: 1
1: 0
2: 0
3: 12
4: 97
Right 961557861 3:127708872-127708894 CCAGCAATCAATTGTAAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 121
961557858_961557861 -1 Left 961557858 3:127708850-127708872 CCATGGCCATGGGCTGCGTGGAC 0: 1
1: 0
2: 4
3: 12
4: 165
Right 961557861 3:127708872-127708894 CCAGCAATCAATTGTAAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 121
961557852_961557861 18 Left 961557852 3:127708831-127708853 CCCGTACAGAGAGCAATGGCCAT 0: 1
1: 0
2: 3
3: 10
4: 117
Right 961557861 3:127708872-127708894 CCAGCAATCAATTGTAAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 121
961557853_961557861 17 Left 961557853 3:127708832-127708854 CCGTACAGAGAGCAATGGCCATG 0: 1
1: 0
2: 0
3: 23
4: 194
Right 961557861 3:127708872-127708894 CCAGCAATCAATTGTAAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961557861 Original CRISPR CCAGCAATCAATTGTAAAAC AGG Intronic
902839700 1:19067130-19067152 CCAGCCATCACTTCTGAAACTGG + Intergenic
907117845 1:51985268-51985290 CAAACAGTTAATTGTAAAACAGG - Intronic
908777521 1:67655594-67655616 ACAGCAAACAATTATAAAGCTGG + Intergenic
913687120 1:121242978-121243000 CCAGCAGCTATTTGTAAAACTGG - Intronic
914038978 1:144030616-144030638 CCAGCAGCTATTTGTAAAACTGG - Intergenic
914150475 1:145037311-145037333 CCAGCAGCTATTTGTAAAACTGG + Intronic
915656839 1:157367621-157367643 CCAGCAATCTATGGTTCAACGGG + Intergenic
918029677 1:180793270-180793292 ACAGCAAGACATTGTAAAACAGG - Intronic
920474448 1:206261499-206261521 CCAGCAGCTATTTGTAAAACTGG - Intronic
921690250 1:218140253-218140275 CCAAAAAACAATTATAAAACTGG - Intergenic
923872616 1:238012462-238012484 GCAGCAAGAAATTGCAAAACAGG - Intergenic
1064214741 10:13390929-13390951 CCAGCAAGCAGTTTTCAAACTGG - Intergenic
1064892708 10:20196268-20196290 ACAGAAATCAGTTATAAAACAGG - Intronic
1066003993 10:31130432-31130454 GCAGCAACCAATTTTAAATCTGG - Intergenic
1066671412 10:37844239-37844261 CCAGCCAGGAATTGTAAACCTGG + Intronic
1068384409 10:56306683-56306705 CCAGCTATCATTTTTAGAACTGG + Intergenic
1075811136 10:125225874-125225896 CTTGCAATGAATTGTAAAAAAGG - Intergenic
1077954158 11:6995510-6995532 TCAGAAATTAATTTTAAAACTGG - Intergenic
1085671811 11:78473255-78473277 GCAGCAATAACTTGTAAAACTGG - Intronic
1099411188 12:82330142-82330164 CAAACAATCCATTGTAAAATGGG - Intronic
1100373102 12:93987532-93987554 CCAACAATCCAAAGTAAAACAGG - Intergenic
1102830648 12:115995792-115995814 TCAGCACTTTATTGTAAAACAGG - Intronic
1111123348 13:83881312-83881334 GCAGAAATAAATGGTAAAACTGG + Exonic
1116243062 14:42371565-42371587 CCTCCAATCAGTTGTTAAACTGG + Intergenic
1116421612 14:44739359-44739381 CTAGCAACCAACTGAAAAACAGG + Intergenic
1120478118 14:85014588-85014610 CCAGCAATCATTTTTGAAATTGG - Intergenic
1125203518 15:37124343-37124365 CCAGAAATCAATTACAAAAGTGG + Intergenic
1125421892 15:39512234-39512256 CCAGCAAGTAATTGCAGAACTGG - Intergenic
1127637341 15:60883922-60883944 CCAGCACTCCTTTGTCAAACTGG + Intronic
1130966151 15:88699459-88699481 CCAGCTGTCCATTGTAAAACTGG - Intergenic
1131884885 15:96901758-96901780 CAAGAAATGAATTGTAAAAGTGG + Intergenic
1135008688 16:18853251-18853273 CCACCAATCAATAGGAACACAGG + Intronic
1138167099 16:54813295-54813317 CCAACATTAAATTGTAAAACTGG - Intergenic
1140720356 16:77765981-77766003 CCAGCAGACAATTGGAAGACAGG - Intergenic
1141607599 16:85163636-85163658 CCAGCAATCATTTATCAAAAGGG + Intergenic
1144059489 17:11569734-11569756 ACAGCCATAAAGTGTAAAACAGG + Intergenic
1144105148 17:11977651-11977673 CCAGAAAGCACTTCTAAAACTGG + Exonic
1144301313 17:13924824-13924846 CCAACAATGAAATGGAAAACTGG + Intergenic
1150180641 17:63116506-63116528 CCGTCAATCACTTGTAAGACAGG - Intronic
1154034553 18:10787370-10787392 TTAGCAATCATTTATAAAACTGG - Intronic
1155532611 18:26782390-26782412 CCAGCAGCCAATTGACAAACAGG + Intergenic
1155968422 18:32057819-32057841 CCAGCAATCTATGTTTAAACAGG - Intronic
1157976492 18:52333533-52333555 CCAAAAATCAGTTGCAAAACTGG + Intergenic
1159321139 18:66850698-66850720 CAAGCAATCAGATGTAAAATGGG + Intergenic
1160134381 18:76260148-76260170 CCAGAATTCAAATGAAAAACAGG - Intergenic
1160439097 18:78875466-78875488 TCAACAAACAATTGTGAAACAGG + Intergenic
926565464 2:14464872-14464894 CCAGAAATAACTTATAAAACAGG + Intergenic
927062287 2:19435092-19435114 CTAGCAATGAATTGGAAATCTGG + Intergenic
929474887 2:42236311-42236333 ATATCTATCAATTGTAAAACGGG - Intronic
931215887 2:60244212-60244234 CCCCCAACCAACTGTAAAACTGG - Intergenic
936063870 2:109316082-109316104 CCAGTATGCAATTGTAAAGCAGG + Intronic
938451624 2:131425668-131425690 CCAGGATTCAATTATAAAATGGG + Intergenic
939102770 2:137914632-137914654 CAAGCAAACAATTGAAATACAGG - Intergenic
940091890 2:149929358-149929380 CCACCAATAAATGGTAAAATTGG - Intergenic
940564270 2:155340409-155340431 CTAGCAAACAATTGTGAAAGGGG - Intergenic
940663198 2:156573264-156573286 TCAACAGTCAATTGTAAAGCAGG + Intronic
942308962 2:174635964-174635986 CCAGCCATCAACTGTCAAAATGG - Intronic
944429083 2:199614058-199614080 GCAGCAATCCATTGTAAAAATGG - Intergenic
945347609 2:208737307-208737329 CCAGCTAACAACTGTACAACAGG - Intronic
947241165 2:227995923-227995945 CCTCCAATCATTTGAAAAACAGG + Intronic
1169499395 20:6144515-6144537 CCAGCAATCATATGAAAAAAAGG - Intergenic
1170054303 20:12182293-12182315 CCACAAATTAATTGTATAACAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174563468 20:51447608-51447630 CCAGCAAAACATTGCAAAACAGG - Intronic
1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG + Intergenic
1182013363 22:27018882-27018904 CCATCCATCCATTGTAAAGCAGG + Intergenic
1184848304 22:47102469-47102491 CCAGCACTCAGTGGGAAAACAGG - Intronic
949619598 3:5795479-5795501 CCAGGGACCAATTGGAAAACAGG - Intergenic
952210795 3:31227326-31227348 ACAGCAAACAATTATAAAAAAGG - Intergenic
954705364 3:52477603-52477625 CCAGCAATCCATTGTGACTCAGG - Exonic
956836275 3:73098761-73098783 TCAGGAAACAGTTGTAAAACTGG + Intergenic
957246518 3:77723155-77723177 CCACCAATGAATTATAAAGCAGG - Intergenic
958157482 3:89773060-89773082 CCAGCAATCAATTCCATTACTGG + Intergenic
958610931 3:96425151-96425173 CCAGCAAACAATCGTGGAACAGG - Intergenic
961557861 3:127708872-127708894 CCAGCAATCAATTGTAAAACAGG + Intronic
968240536 3:197079591-197079613 CCATCAATAAATTGAAAAAGAGG - Intronic
972499361 4:39662994-39663016 ACTGAAATCAACTGTAAAACTGG + Intergenic
975798929 4:78038195-78038217 CAATTAATCAATTGTAAAAATGG + Intergenic
978472613 4:109086665-109086687 CCAGCAGTCAAGCATAAAACAGG - Intronic
989128208 5:38077565-38077587 CCAGAAGCCAATTGTAGAACAGG - Intergenic
992085322 5:73273186-73273208 CCACCCATCAATTGTGAAAAAGG + Intergenic
994400275 5:99271247-99271269 CCAGAAAACAATCATAAAACAGG - Intergenic
994503684 5:100612845-100612867 CCACCAATCTAGTGTAATACTGG - Intergenic
994917223 5:105995716-105995738 GCAACTATCATTTGTAAAACTGG - Intergenic
996516220 5:124372562-124372584 CCAGGTATCCATTGTAAATCAGG - Intergenic
996662372 5:126019718-126019740 CCAGGACTCACTTGGAAAACTGG - Intergenic
996907863 5:128622042-128622064 CCATCAGTGAATTGTAAAACAGG + Intronic
999340229 5:150763901-150763923 CCAGGAATAAATTGTAAGAGGGG - Intergenic
1001569438 5:172720510-172720532 GCAGCAATCCTTTGTAAACCTGG + Intergenic
1003270734 6:4605744-4605766 CCAACAATCAAATGTATAAAGGG + Intergenic
1003309171 6:4953782-4953804 CCAGCAATCACCTGTTAAAAAGG - Intronic
1006281405 6:33056779-33056801 CCAACATTGAATTGTAAAACCGG + Intergenic
1006601156 6:35227139-35227161 CCAGCAATCACTAGTAAAGGAGG - Intronic
1008344374 6:50408329-50408351 CCAAAAATCAAAAGTAAAACTGG - Intergenic
1008515283 6:52313099-52313121 CCAGCAATCAAGGGCTAAACTGG - Intergenic
1009960581 6:70516097-70516119 TCTGCAAACAACTGTAAAACTGG - Intronic
1015671525 6:135696098-135696120 CAAGTAATAAATTGTAAAAGAGG - Intergenic
1016207747 6:141490546-141490568 CAAGCAATCAATTCTACAGCAGG + Intergenic
1017577716 6:155823648-155823670 CCAGCCAGCAGTTGTAAAAGTGG - Intergenic
1017630245 6:156389877-156389899 CCAGCCATCACTGCTAAAACAGG + Intergenic
1022916325 7:34957821-34957843 CAAGTACTCAATTCTAAAACAGG - Intronic
1026042255 7:66877941-66877963 CCAGCAGCTATTTGTAAAACTGG - Intergenic
1028080941 7:86575123-86575145 CCAACAATCAATTTAAAAATAGG + Intergenic
1028525293 7:91777940-91777962 TCAGCAATTAATTATAAAAATGG + Intronic
1034360066 7:150487622-150487644 CCAACAATTCATTGTAAAAATGG - Intergenic
1035719237 8:1779007-1779029 TCAGCATTCTGTTGTAAAACAGG - Intronic
1038862191 8:31399941-31399963 CCCACAATCAATTGAAAAATGGG - Intergenic
1039184515 8:34901665-34901687 CAAGCAATGAAATGTCAAACTGG - Intergenic
1042348662 8:67753398-67753420 CCAGCATTCCATTGAAAAAAAGG - Intergenic
1042356073 8:67829261-67829283 CTCCCAATCAATTGAAAAACGGG - Intergenic
1047899305 8:129402672-129402694 CCAGGAATCATTAGGAAAACTGG - Intergenic
1048483466 8:134825138-134825160 CCAGCAATAACATGTAAAACTGG + Intergenic
1048631918 8:136252727-136252749 CCAGCACTCTATTGTAAAGCAGG + Intergenic
1052012737 9:23430150-23430172 CCAGCAACCAATAGTAATAGAGG + Intergenic
1054813591 9:69454251-69454273 CCATCTACCTATTGTAAAACTGG + Intronic
1055204351 9:73709604-73709626 ACATCAATCAATTGAAAGACTGG - Intergenic
1057260976 9:93583737-93583759 CAAGCAATCCAATGTAAAAGTGG - Intronic
1057366050 9:94422169-94422191 CCAGCAATAAACTGTAACAATGG - Intronic
1057657282 9:96965896-96965918 CCAGCAATAAACTGTAACAATGG + Intronic
1057760542 9:97870397-97870419 CCAGAAAGCAATTGCAAATCAGG + Intergenic
1058198230 9:102006013-102006035 CAAGAAATGTATTGTAAAACAGG - Intergenic
1060558140 9:124520388-124520410 GCTGCAAACATTTGTAAAACTGG + Exonic
1188361206 X:29256285-29256307 CCAGCAATCCTTTGTGAAAAAGG - Intronic
1188918622 X:35944153-35944175 CCTGGAATCAACTGTAAACCAGG + Intronic
1188975864 X:36674893-36674915 CCAACAATCATATGAAAAACTGG - Intergenic
1191923787 X:66286816-66286838 CCAACAACCAATTTTAAAAATGG + Intergenic
1192969021 X:76211484-76211506 CTACCAAGCAATTGGAAAACAGG + Intergenic
1193316694 X:80073177-80073199 CCACCAAACAAATGGAAAACAGG - Intergenic
1194732518 X:97472694-97472716 CAAGCAAGCAATTATAATACAGG - Intronic
1194776268 X:97968807-97968829 CCCTCAATTCATTGTAAAACCGG + Intergenic