ID: 961561172

View in Genome Browser
Species Human (GRCh38)
Location 3:127731308-127731330
Sequence ATGCCTGGCTGCTCTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961561164_961561172 18 Left 961561164 3:127731267-127731289 CCTCAACCTCCCAAGTACTGGGA 0: 5
1: 97
2: 689
3: 2850
4: 18369
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170
961561159_961561172 24 Left 961561159 3:127731261-127731283 CCCCTGCCTCAACCTCCCAAGTA 0: 52
1: 1862
2: 3932
3: 5680
4: 6072
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170
961561165_961561172 12 Left 961561165 3:127731273-127731295 CCTCCCAAGTACTGGGACTACAG 0: 29
1: 210
2: 1643
3: 6711
4: 9289
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170
961561161_961561172 22 Left 961561161 3:127731263-127731285 CCTGCCTCAACCTCCCAAGTACT 0: 4
1: 229
2: 6098
3: 94427
4: 199014
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170
961561160_961561172 23 Left 961561160 3:127731262-127731284 CCCTGCCTCAACCTCCCAAGTAC 0: 1
1: 107
2: 2599
3: 4938
4: 6791
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170
961561168_961561172 8 Left 961561168 3:127731277-127731299 CCAAGTACTGGGACTACAGGCGC 0: 19
1: 62
2: 288
3: 1947
4: 7226
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170
961561167_961561172 9 Left 961561167 3:127731276-127731298 CCCAAGTACTGGGACTACAGGCG 0: 35
1: 4420
2: 137951
3: 288835
4: 276711
Right 961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG 0: 1
1: 0
2: 1
3: 21
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961561172 Original CRISPR ATGCCTGGCTGCTCTCTTGG TGG Intronic
900500766 1:3003450-3003472 CTGCACGGCTGCTGTCTTGGGGG + Intergenic
901323729 1:8355191-8355213 TTGCCTGGCTGTTGTCTTTGGGG - Intronic
901488988 1:9586627-9586649 ATGCCTGCCTGCTGTTTTGAGGG + Intergenic
902303760 1:15521693-15521715 ATGCCTGGCTGCGCTGTTATTGG - Intronic
905455579 1:38085875-38085897 ATTCCTGGTTGCTGTCTTGGAGG + Intergenic
906797742 1:48711188-48711210 AGGCTGGGCTGCACTCTTGGGGG + Intronic
907368013 1:53978757-53978779 ATGCCTGGCCCCTCTCTTCTTGG - Intergenic
910440489 1:87246823-87246845 ATTCCTGGATGCTCTTTAGGAGG - Intergenic
915729547 1:158043475-158043497 CTGCCTGGCTGCTCCCTTTCAGG + Intronic
916315057 1:163439608-163439630 ATGCCCTGGTGTTCTCTTGGAGG + Intergenic
916691979 1:167198720-167198742 ATCCCTGTCTGCTCTCTCAGAGG + Intergenic
917610575 1:176685030-176685052 ATGCCTGGTTTCACTCTGGGAGG + Intronic
917648175 1:177048911-177048933 ATCTTTGGCTGCTCTGTTGGAGG - Intronic
922204926 1:223437797-223437819 CTGCCTGGCTGAAATCTTGGAGG - Intergenic
923000521 1:230003077-230003099 CTGCCTGGCTGCTTTCCTGGAGG - Intergenic
923211421 1:231807324-231807346 ATGCCTGGCTGCTCTGATGCTGG + Intronic
924267709 1:242300144-242300166 ATGCCTGGCTGATATCTTCTTGG - Intronic
1063734272 10:8734727-8734749 CTCCCTGGCTGCTCTGTGGGAGG + Intergenic
1064492134 10:15870326-15870348 ATGCCTGGCTAATTTTTTGGAGG + Intergenic
1067563738 10:47322068-47322090 AAGCCTCCCTGCTCTGTTGGTGG - Intergenic
1068136527 10:52954938-52954960 CTGCCTGGCTGCTCCCCTTGCGG + Intergenic
1069926819 10:71856258-71856280 GAGCCAGGCTGCTGTCTTGGAGG + Intergenic
1070474417 10:76817792-76817814 ATGCCTGGCTGCTAGGGTGGAGG + Intergenic
1074043971 10:109819896-109819918 ATGGCTGGCTGCTCTTTCTGAGG + Intergenic
1074061197 10:109967447-109967469 GTGCCTGGCTGCTCTGCTAGCGG + Intergenic
1074979854 10:118610732-118610754 CTCCCTGGCTGGTCTCATGGGGG - Intergenic
1075007688 10:118842427-118842449 AGGCATCCCTGCTCTCTTGGGGG + Intergenic
1075278872 10:121121609-121121631 AAACTTGGCTGTTCTCTTGGTGG - Intergenic
1075401522 10:122164298-122164320 ATGCCTGGCTGTTCCCTTGCAGG - Intronic
1075457311 10:122593181-122593203 ATGCCTGGCCTGTCTCATGGGGG - Intronic
1075458382 10:122599676-122599698 ATGCCTGGCCGGCCTCATGGGGG - Intronic
1076512842 10:131024779-131024801 CTGCCTTGCTCCTCTCCTGGGGG + Intergenic
1076653140 10:132003768-132003790 ATCCCTGGCTGCCATCTGGGAGG + Intergenic
1081237080 11:40659052-40659074 AGGCATTGCTGCACTCTTGGGGG + Intronic
1083154013 11:60811319-60811341 AGGCATGGCTGCTTTCTGGGTGG + Intergenic
1083853856 11:65382487-65382509 AGGCCTGGCTGTTCTCTTCAGGG + Exonic
1084049712 11:66591866-66591888 AGGCCTGCCTCCTCTCCTGGGGG - Exonic
1096751640 12:53762923-53762945 ATGCCTGGCTAATTTTTTGGAGG + Intergenic
1101456225 12:104834115-104834137 ATGACTGTCTGCTTTATTGGAGG - Intronic
1104498480 12:129262990-129263012 ATTCCTGTCTGCTCTATTGTTGG - Intronic
1105274313 13:18905841-18905863 ATCCCTGGCTGCACTGCTGGGGG + Intergenic
1105901801 13:24761733-24761755 ATTTCTGGCTGCTCTATTTGAGG + Intergenic
1106201240 13:27539034-27539056 ATCCTTGCCTGGTCTCTTGGCGG - Intergenic
1106553336 13:30789886-30789908 AGGCCTGGCTGCTCTCTTAGGGG - Intergenic
1108359908 13:49659584-49659606 ATGCTTGGCTAAGCTCTTGGGGG + Intergenic
1110419992 13:75296921-75296943 ATTTCTTGCTTCTCTCTTGGTGG - Intronic
1110597715 13:77337543-77337565 GTGCCTGGCTGGTCTCCTTGAGG - Intergenic
1112829567 13:103432172-103432194 ATGCTTGGCAGCACTCTTGATGG + Intergenic
1113348783 13:109508028-109508050 AAGCCAGGCTGCTGTCTTGCAGG + Intergenic
1114611443 14:24044019-24044041 ATGGCTTGGTGCTCTCCTGGTGG - Intergenic
1114895862 14:26990596-26990618 ATGTCTGCCTGGTATCTTGGGGG - Intergenic
1117768401 14:59107390-59107412 ACGTCTGGCTGCTCTCCTGGAGG - Intergenic
1119895151 14:78213779-78213801 ATGCCTCATTGCTCTCTGGGTGG - Intergenic
1120650769 14:87130123-87130145 ATGCCTGTCTGCACTTTAGGAGG - Intergenic
1121403604 14:93704147-93704169 ATGCCTGGCTGCGATCTGGAAGG - Intronic
1124553798 15:30707660-30707682 ATGCTTGGCTGCTGTCCTGGTGG + Intronic
1124677449 15:31698012-31698034 ATGCTTGGCTGCTGTCCTGGTGG - Intronic
1124718109 15:32085870-32085892 ATTCCTGGCTGCTCTTATTGTGG + Intronic
1127140172 15:55967853-55967875 ATGCCTGGCTTATTTTTTGGAGG - Intronic
1127698321 15:61473221-61473243 CTGCCTGCCTCCTCTCCTGGGGG + Intergenic
1129392752 15:75228796-75228818 CTGCCCTGCTGCTCTCTTGGGGG - Intergenic
1137388546 16:48061989-48062011 ATGCTTGGCTTCTATCTTGCAGG - Intergenic
1137723596 16:50642127-50642149 ATGCCCCCCAGCTCTCTTGGAGG + Intergenic
1138033319 16:53578540-53578562 ATGGCTGGCTGATCTCCTTGAGG + Intergenic
1139254183 16:65525256-65525278 AAGCCTGGCTGGTTTCTTGATGG - Intergenic
1139486661 16:67260841-67260863 ATGGCTTGCTGCCCTCTTGTGGG - Intronic
1139662258 16:68429200-68429222 ATGCCTGTCTGCTTTCTTGCTGG + Intronic
1143598092 17:7927694-7927716 GTGCCTGGCTTCTCTCTTGCAGG - Exonic
1144372727 17:14607454-14607476 AATCCTGGCTGCTCTATTTGCGG - Intergenic
1146816417 17:35945662-35945684 ATGTCTGGGTGCTCTGTTGATGG + Intergenic
1148705158 17:49623641-49623663 ATTGCTGGCTGCTCTCTTGAAGG + Intronic
1149012024 17:51866652-51866674 ATTCCTGGCTTCTCCTTTGGAGG + Intronic
1151660008 17:75514144-75514166 AATGCTGGCTGCTCTCTGGGTGG - Exonic
1151963674 17:77420208-77420230 TTGCCTGGCTGCTCTGTCTGGGG + Intronic
1152153707 17:78618951-78618973 ATCCCTGGATGCTGGCTTGGCGG - Intergenic
1152344670 17:79743718-79743740 AGGCCTGGCTGCACGCATGGGGG + Intergenic
1153415140 18:4838172-4838194 AGAACTGGCTGCTCACTTGGTGG - Intergenic
1153635134 18:7106932-7106954 CTGGCTGGCTGCTTTATTGGAGG - Intronic
1153809265 18:8737587-8737609 ATGCCTGGCTGCCCTCGCGTTGG - Intronic
1153972690 18:10240812-10240834 ATGCCTGGCTGTCCTCTTCATGG - Intergenic
1154466007 18:14643096-14643118 ATCCCTGGCTGCACTGCTGGAGG + Intergenic
1155070778 18:22314097-22314119 ATGACCGGCTGCTACCTTGGAGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158320058 18:56252516-56252538 ATGGCTGGCTGCTCTGTTTAGGG - Intergenic
1158432292 18:57400292-57400314 ATGCCTGGTTGATCTCTTTGAGG - Intergenic
1161000873 19:1910152-1910174 ATGGCTGGCTCCTCTCTGCGGGG + Intronic
1162714361 19:12620514-12620536 ATGCCTGGGTGCTCTCTGTAAGG - Intronic
1162885863 19:13696682-13696704 CTACCTGGCTCCTATCTTGGAGG + Intergenic
1166662896 19:44658747-44658769 ATGCCTGAGTGCTCACTGGGAGG - Exonic
1167163150 19:47780543-47780565 GTGCCTGTCTTCTCTCTTGAGGG + Intronic
1168714276 19:58518054-58518076 ACACCGGGCTGCCCTCTTGGAGG - Intronic
925167637 2:1728055-1728077 AGTCCTGGCTACTCACTTGGAGG - Intronic
927372553 2:22373621-22373643 ATGCCTTGCTTTTCTCTTTGTGG - Intergenic
927514590 2:23664748-23664770 ATGGCAGGCTGCTGTCTTGAAGG - Intronic
929957056 2:46466108-46466130 ATGCCTGGCTGATTTATTGAGGG - Intronic
931509052 2:62968935-62968957 TTGTCTGGCTGCTCTTTTGTAGG - Intronic
932273889 2:70436507-70436529 ATGACTGGCTGCTCTATATGGGG - Intergenic
933304675 2:80582355-80582377 ATGCCTGTCTACTCCCATGGTGG + Intronic
935518849 2:104078727-104078749 CTGCATCTCTGCTCTCTTGGGGG - Intergenic
935652118 2:105391371-105391393 ATGCCTGCCTGCTCTCTCAGGGG - Intronic
936086306 2:109471885-109471907 ATGCCTGGCAGTTCTCTAGAAGG + Intronic
937200985 2:120204405-120204427 ATTTCTGGCTGGCCTCTTGGGGG + Intergenic
937201855 2:120209173-120209195 AGGCCTGGCTGCCCTCCTGAGGG + Intergenic
937319528 2:120952766-120952788 ATGCCCAGCTGCTGTCTTGTTGG + Intronic
938121405 2:128636749-128636771 ATGCCTGTCTCCCTTCTTGGAGG + Intergenic
940771112 2:157840366-157840388 ATTCCTGGATGCTCTAATGGTGG - Intronic
941101831 2:161305272-161305294 ATGAGTGGCTTCTCTCTTTGTGG + Intergenic
941983176 2:171482784-171482806 ATTCCTGGCTGCTTTTTTGCTGG + Exonic
942433922 2:175950044-175950066 ATGCTTGGTGGCTCTTTTGGGGG - Intronic
942952044 2:181732044-181732066 ATGCCAGGCTGCTGCCTTGCAGG - Intergenic
946018263 2:216621293-216621315 ATGGATGGCTGCTCTAATGGGGG + Intergenic
946913515 2:224490450-224490472 ATGCCTGGCTGCGCTGTTATTGG - Intronic
947032821 2:225817436-225817458 ATCACTGGCTGCTCTCTAGAAGG + Intergenic
947100955 2:226620821-226620843 CTGCTGGGCTCCTCTCTTGGGGG + Intergenic
1170139741 20:13113437-13113459 TTGGCTGACTGCTCTCTTTGGGG - Intronic
1170613610 20:17932833-17932855 ATGCCTGGCCCAGCTCTTGGTGG - Intergenic
1172356706 20:34285331-34285353 TTGCCTGTCTGCCCTCTTAGAGG - Intronic
1174340774 20:49893594-49893616 ATGCCTGCCTGCTCTCCTGCAGG - Intergenic
1174680821 20:52406537-52406559 TTGCCTGGCAGTTTTCTTGGAGG + Intergenic
1176379351 21:6104082-6104104 ATGCCTGGCAGATCCCATGGAGG - Intergenic
1176808579 21:13515500-13515522 ATCCCTGGCTGCACTGCTGGAGG - Intergenic
1179744122 21:43434155-43434177 ATGCCTGGCAGATCCCATGGAGG + Intergenic
1181112974 22:20612652-20612674 ATGCCTGGCTGGTGCCTGGGGGG - Intergenic
1183214208 22:36468567-36468589 ATGCCTGGCTAATATTTTGGGGG - Intronic
949365526 3:3276543-3276565 AGGCTGGGCAGCTCTCTTGGAGG + Intergenic
950886388 3:16366418-16366440 GTGCCTGGCTGCTCTATATGTGG + Intronic
951569711 3:24049084-24049106 AAACCTGGCTGATCTATTGGAGG + Intergenic
956886750 3:73568028-73568050 ATGCCTGATTTCTCTATTGGAGG - Intronic
959073517 3:101725658-101725680 ATGCCAGATTGCTCTCCTGGAGG - Intronic
960210845 3:114964092-114964114 ATGCCTGGCTCCTTTCTAGATGG - Intronic
960853181 3:122077056-122077078 ATGCCTCCCTGATCTCTTGGAGG - Intronic
961561172 3:127731308-127731330 ATGCCTGGCTGCTCTCTTGGTGG + Intronic
962242627 3:133764028-133764050 GTGCCTGGCTGATCTTTTGGGGG + Intronic
962482076 3:135806631-135806653 GGGCCTGGGGGCTCTCTTGGAGG + Intergenic
964378395 3:156072307-156072329 AGGCGCAGCTGCTCTCTTGGTGG + Intronic
967833158 3:193939491-193939513 ATGGATGGCTGGTCTCTTGAGGG + Intergenic
968631097 4:1651913-1651935 GTGCCTGGTTTCTCTCTGGGAGG - Intronic
968987042 4:3881112-3881134 CTTCATGGCTGCTCTCATGGAGG - Intergenic
973875719 4:55216646-55216668 ATGCCTGGCTGTTTTTTTTGGGG + Intergenic
973879631 4:55256307-55256329 ATGCCTGGCTGGTCTGTTTTGGG - Intergenic
980180126 4:129392350-129392372 AGGCCTCCCTGCACTCTTGGAGG + Intergenic
981445819 4:144837119-144837141 CTGCCAGGCTGCTGTCTTGCAGG - Intergenic
983676309 4:170297669-170297691 ATGCCTGACTGCTCCCATGTTGG - Intergenic
985631225 5:1015081-1015103 ACACCTGGCTGCTCTCCAGGTGG - Intronic
985665533 5:1180062-1180084 ATGCCTGGCTGAGCTCAGGGCGG + Intergenic
988856563 5:35233261-35233283 CTCACTGGCTGCTCTCTGGGAGG + Intergenic
989120952 5:38004057-38004079 ATGCATGGCTGCTTCCCTGGGGG + Intergenic
991488935 5:67165066-67165088 AGGCCTGGCTTCTCCCTTGAGGG - Exonic
993179013 5:84524686-84524708 AGGCATGGCTGATCTCTTGTTGG - Intergenic
997225424 5:132205926-132205948 ATGCCTGGCAGCTGTCTGTGGGG - Intronic
997625858 5:135330176-135330198 AATCCTGGCTGCTCTCTGGCCGG + Intronic
998830008 5:146147273-146147295 ATGCCTGGCTGATTTGTTGTAGG - Intronic
1003072362 6:2955277-2955299 ATGCATGGCTGCTCCCTTAAAGG - Intronic
1003854259 6:10256250-10256272 GAACCTGGCTGATCTCTTGGAGG - Intergenic
1005332287 6:24761598-24761620 AAGCCTCCCTGTTCTCTTGGAGG - Intergenic
1006897291 6:37479312-37479334 ATGCCAGCCAGCTGTCTTGGGGG + Intronic
1008522582 6:52376350-52376372 ATGCCAGGCTGCTTTCTGGGTGG + Intronic
1010527343 6:76918957-76918979 ATGCTTGGCTTCTTTCTTGGTGG - Intergenic
1011659832 6:89584886-89584908 ATGGCTGGCTTCTCTCTGTGTGG + Intronic
1012587721 6:100944761-100944783 ATGCAGGACTGCTCTCTGGGTGG + Intergenic
1014087823 6:117367856-117367878 ATGCCTGGCTGTTCATTTTGGGG - Intronic
1014274595 6:119373409-119373431 AGACCAGTCTGCTCTCTTGGGGG + Intergenic
1016131322 6:140475329-140475351 ATGCCTGGATGCTCTGTGGTAGG - Intergenic
1018180908 6:161222765-161222787 ATGCCTGCCTGCTCTCCTGCAGG + Intronic
1019622696 7:2000349-2000371 ATGCCTGGCTGCTCTGTGCAGGG - Intronic
1022149025 7:27579823-27579845 ATACCTCGCTGCTTTTTTGGTGG - Intronic
1022498954 7:30870833-30870855 ATACCTGGCCTCTCTCTTTGGGG + Intronic
1022865213 7:34411025-34411047 ATGCCTGGCTACTTTTTTGTGGG - Intergenic
1029195980 7:98805769-98805791 ATGCCTCGCTGCTCCCTTTCAGG - Intergenic
1035522763 8:288332-288354 AGGACGGGCAGCTCTCTTGGGGG + Intergenic
1036687277 8:10920279-10920301 ATATCTGGCTGTTTTCTTGGTGG - Intronic
1037480383 8:19299764-19299786 AAGCCTGTCTTCTCTCTTTGAGG - Intergenic
1037747807 8:21660905-21660927 ATGCCTGGCTGCCCACTTACTGG - Intergenic
1038302221 8:26363016-26363038 ATTCCTGGAAGCTCTCTTGGGGG + Intronic
1043152138 8:76731020-76731042 AACCCTGGCTTCTCTCCTGGAGG + Intronic
1044820549 8:96153262-96153284 ATGGCTGCGTGCTCTCTTGAGGG + Intronic
1045796760 8:106055432-106055454 TTGCCTTGTTGCTCTTTTGGAGG - Intergenic
1045935459 8:107673407-107673429 ATGCTAGACAGCTCTCTTGGAGG - Intergenic
1045958550 8:107939015-107939037 ACACCTGGCTTCGCTCTTGGAGG - Intronic
1046637012 8:116680905-116680927 ATGTCTGGGTGCTCTGTTGATGG + Intronic
1055719612 9:79157027-79157049 ATGGATGGCTTCTCTCATGGTGG - Intergenic
1057690256 9:97277534-97277556 AAGCCTGTCTGCTCTCTTACAGG + Intergenic
1057840478 9:98482026-98482048 GGGCCTGGCTGGTCTCCTGGTGG - Intronic
1057905211 9:98977627-98977649 ATGGCTGGCCTCCCTCTTGGCGG + Intronic
1059430767 9:114248900-114248922 ATGTCTGACTGCTCCCTTGTGGG + Intronic
1059738265 9:117123914-117123936 ATGCCTGTCTGTGCTTTTGGAGG + Intronic
1060918290 9:127403952-127403974 AGGCCAGGCTGCTGTCCTGGGGG - Exonic
1061028683 9:128066955-128066977 GTGCCAGGCCGCACTCTTGGCGG + Exonic
1061201500 9:129140893-129140915 GTGCCTGGCTGCCCTCCTGGAGG + Intronic
1187293267 X:17975562-17975584 ATGCATTGCTGCTCTCATGCAGG - Intergenic
1187747273 X:22423211-22423233 AAGGCTGGCTGCTTTTTTGGTGG - Intergenic
1188422599 X:30008147-30008169 AAGCCTGGCTGGCCTCCTGGTGG + Intergenic
1195219964 X:102737581-102737603 ATGCCTGGCTGCTGGCTTCTGGG + Intronic