ID: 961563979

View in Genome Browser
Species Human (GRCh38)
Location 3:127750237-127750259
Sequence TTCTGGGTTTGCTGTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961563970_961563979 13 Left 961563970 3:127750201-127750223 CCCGTTCGTCTCCTGGTGTAATC 0: 1
1: 0
2: 0
3: 1
4: 51
Right 961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG 0: 1
1: 0
2: 2
3: 50
4: 468
961563974_961563979 2 Left 961563974 3:127750212-127750234 CCTGGTGTAATCAGGGCACCGTT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG 0: 1
1: 0
2: 2
3: 50
4: 468
961563971_961563979 12 Left 961563971 3:127750202-127750224 CCGTTCGTCTCCTGGTGTAATCA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG 0: 1
1: 0
2: 2
3: 50
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961563979 Original CRISPR TTCTGGGTTTGCTGTGGAGA AGG Intronic
900481691 1:2902559-2902581 TCCTGGGTGTGGTGTGGAGTGGG + Intergenic
902518038 1:17000302-17000324 GTCTGGCTTTGCTGTGGGCAGGG + Exonic
902717151 1:18280747-18280769 TTCTGGGGGTGCTGTGTAGAAGG - Intronic
902739255 1:18423414-18423436 TTTTTGGTTTACAGTGGAGAGGG - Intergenic
903697345 1:25217718-25217740 TTCTGGGATGGCTCTGGAGGGGG - Intergenic
903958316 1:27040274-27040296 TTCTGGCTGCCCTGTGGAGAAGG - Intergenic
905082258 1:35334143-35334165 TTCTGTATTTTCTGTAGAGATGG - Intronic
905627295 1:39497685-39497707 TTCAGGGGTTGCTGGGGAGTAGG - Intronic
905927316 1:41760688-41760710 TCCTGGCTTAGTTGTGGAGAGGG - Intronic
905938549 1:41844178-41844200 TTCTCAGTTTGCAGTGGAGGTGG - Intronic
906124076 1:43415890-43415912 TTCTGGCTTTGCTATGGATGGGG + Intronic
906805817 1:48777736-48777758 TGGTGGGCGTGCTGTGGAGAGGG - Intronic
907775045 1:57506045-57506067 TTCTGCCTTTGCTGAAGAGAGGG + Intronic
908862767 1:68508223-68508245 TTTTGTGTTTTCAGTGGAGACGG + Intergenic
909699308 1:78503734-78503756 TTCTGGCTTTGCTTTGGAGCAGG + Intronic
909725268 1:78827309-78827331 CTCTGGATTTGCTCTTGAGAAGG + Intergenic
910046845 1:82927859-82927881 TTCTGGTTCCCCTGTGGAGATGG + Intergenic
910810861 1:91234726-91234748 TTATGGTTCTGATGTGGAGAAGG + Intergenic
911444974 1:97981388-97981410 TTCTGGGATACCTGTGCAGAAGG + Intergenic
912390595 1:109300055-109300077 TTCTACATTTGCTGGGGAGAGGG + Intronic
912666595 1:111586410-111586432 TTTTGTGTTTTTTGTGGAGATGG - Intronic
912749091 1:112270616-112270638 TACTGGTTTTACTGGGGAGATGG - Intergenic
914262476 1:146010752-146010774 TTTTGGGTTTTCTTTTGAGAGGG + Intergenic
914387778 1:147188351-147188373 TTTTGTGTTTTCTGTAGAGATGG - Intronic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
917153680 1:171972512-171972534 TTGAGTGTTTGCTGTGCAGAAGG + Intronic
917934279 1:179849397-179849419 TTTTGTGTTTTCTGTAGAGATGG + Intronic
918290517 1:183103204-183103226 TTCTTGGTTTGATGTGTACAAGG + Intronic
918415675 1:184304661-184304683 TACTTGCTTTGCTGTGCAGAAGG + Intergenic
919002690 1:191853713-191853735 TGCTGGGTGTTCTGTGGAGAAGG + Intergenic
919164902 1:193880082-193880104 TTTTGGTTTTGGTTTGGAGACGG - Intergenic
920339811 1:205268743-205268765 TTTTGGGGATGCTGTGGGGACGG + Intronic
921405561 1:214775527-214775549 TTTTGTGTTTTCTGTAGAGATGG - Intergenic
921560359 1:216650922-216650944 TTTTGATTTTGCTGTGGGGATGG - Intronic
922678566 1:227570110-227570132 TTCAGGGCTTTCTGTGGAGCAGG + Intronic
922797388 1:228347167-228347189 CTCTGTGTTTGCGGTAGAGACGG - Intronic
923156104 1:231280770-231280792 TACTGTGTTTGATGGGGAGATGG - Intergenic
924894017 1:248316639-248316661 TTCTGGATTTCCTGCAGAGATGG + Intergenic
924937622 1:248785364-248785386 TTCAGGGTTTCCTGTGGGGAGGG + Intergenic
924953992 1:248909945-248909967 TTCTTGGTAGGCTGTGAAGATGG + Intronic
1062811866 10:472627-472649 CTCTGGCTTTGCTGTGGGGATGG - Intronic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1064064843 10:12173111-12173133 TTTTGAGTTTGATGTGGTGAAGG - Intronic
1064282465 10:13964053-13964075 TTCTGGGTTGGCTGTGTTGAGGG - Intronic
1064576107 10:16747860-16747882 TTCTCAGTTTTTTGTGGAGATGG - Intronic
1064735716 10:18379855-18379877 TTTTGTATTTTCTGTGGAGACGG + Intronic
1064774131 10:18756569-18756591 TTTTGTATTTTCTGTGGAGACGG + Intergenic
1064939333 10:20715061-20715083 TTGTGAGTTTCCTCTGGAGAGGG - Intergenic
1066028609 10:31393005-31393027 TTCTGTGTTTTTTGTTGAGACGG + Intronic
1066041473 10:31552198-31552220 TTCTGGGATTCCTGTGGCCATGG - Intergenic
1067283488 10:44890825-44890847 TTCTGGGTGTGGTGTGGAAAAGG - Intergenic
1067507677 10:46870504-46870526 TGGTGGGTTTGCTGAGAAGATGG + Intergenic
1067510558 10:46891541-46891563 CTTTGGGTTTGCTGTGGTGCTGG - Intergenic
1067654578 10:48181341-48181363 TGGTGGGTTTGCTGAGAAGATGG - Intronic
1067851125 10:49755071-49755093 TTTTGTGTTTTCAGTGGAGACGG - Intronic
1069028934 10:63575237-63575259 TTCTGGTGTTGCTGTTGAGAAGG + Intronic
1070338426 10:75475242-75475264 TTCTGGGTTTCCTGGGGAGATGG + Intronic
1071184314 10:83023205-83023227 TTCTGGGTTACATGTGCAGAAGG - Intergenic
1071792757 10:88973208-88973230 TTCTGGCACTGCTTTGGAGATGG + Intronic
1072066827 10:91879565-91879587 TTCTGGGTGGGGTTTGGAGAGGG - Intergenic
1072623579 10:97096708-97096730 TTCTGGGTTTGCTGGGGGAAGGG - Intronic
1073160183 10:101386945-101386967 TTTTGGGTTTGATGTGACGAAGG + Intronic
1073162626 10:101413127-101413149 TTTTGGGTTTGTTTTTGAGATGG + Intronic
1073307246 10:102512896-102512918 TTCTGTATTTTCTGTAGAGATGG - Intronic
1073815445 10:107201575-107201597 TTCTGTGTTTTTTGTAGAGATGG + Intergenic
1074296568 10:112194853-112194875 TTCTTGGCCTGCTGAGGAGATGG - Intronic
1074363509 10:112840460-112840482 TTCTGAGTTTGCTGTAGCAAAGG - Intergenic
1075149205 10:119911644-119911666 TTTTAAGTTTTCTGTGGAGATGG + Intronic
1075341575 10:121650505-121650527 TTTTGTGTTTTTTGTGGAGACGG - Intergenic
1076215537 10:128690739-128690761 TTCTGGCTTTGCTGTCAACAAGG - Intergenic
1076625576 10:131819580-131819602 TGCTGGGTTTGCTGCGGGGGTGG + Intergenic
1076994258 11:290540-290562 GTCTGGGCTTTCTGGGGAGAAGG - Exonic
1077269076 11:1666581-1666603 GCCTGGGTTGGCGGTGGAGATGG - Intergenic
1077269495 11:1668737-1668759 TTCTGTGTTTTCAGTAGAGATGG - Intergenic
1077271471 11:1684133-1684155 GCCTGGGTTGGCGGTGGAGATGG + Intergenic
1077582799 11:3427779-3427801 TTCTGTATTTTCTGTAGAGATGG + Intergenic
1079810629 11:24995220-24995242 TTCTGTATTTTCTGTAGAGATGG - Intronic
1080973804 11:37310361-37310383 TTCTGTGTTTTTTGTGGAGGTGG + Intergenic
1082858846 11:57834268-57834290 TTTTGGGTTTTTTGTAGAGATGG - Intergenic
1083910656 11:65707311-65707333 TTTTGTATTTTCTGTGGAGATGG - Intergenic
1084845495 11:71896105-71896127 TTTTGTGTTTACCGTGGAGACGG - Intronic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085289469 11:75387433-75387455 TTCTCTGTCTGGTGTGGAGAAGG - Intergenic
1085290699 11:75397162-75397184 TTCTGTGGTTGCTGAGCAGAGGG - Intergenic
1086485098 11:87291711-87291733 TTTTGTGTTTTCTGTAGAGATGG + Intronic
1087692670 11:101339870-101339892 TTCTGTGTTTTCAGTAGAGACGG + Intergenic
1088243366 11:107793085-107793107 TTTTGTGTTTTCTGTAGAGACGG + Intronic
1088267440 11:108001226-108001248 TTTTGTGTTTTCTGTGGAGATGG + Intergenic
1088329330 11:108633928-108633950 TTTTGTGTTTTTTGTGGAGATGG - Intergenic
1088545656 11:110956210-110956232 TCAGGGGTTTGCTCTGGAGAGGG + Intergenic
1089128519 11:116193917-116193939 GTCTGGGTTTGATGGGGAGGGGG + Intergenic
1089269818 11:117294385-117294407 TTCTGTGTTTTCAGTAGAGATGG + Intronic
1089515272 11:119028093-119028115 CTCTGGGTTGGGTGTGGAGGTGG + Intronic
1089627642 11:119761790-119761812 TTTTGTGTTTTCAGTGGAGATGG + Intergenic
1089901269 11:121988302-121988324 TACTGGGTTTGCTGTGATGAGGG + Intergenic
1091665538 12:2416007-2416029 TTCAGGCTTTGCTGAGGTGAGGG + Intronic
1092392155 12:8090229-8090251 TCCTGGTATTGCTGTGGAGACGG + Exonic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092570906 12:9720247-9720269 TACTGTGTGTGCTGGGGAGAAGG - Intronic
1093387552 12:18577060-18577082 TTCTGGGACTGGTGTGAAGAAGG + Intronic
1093421058 12:18975605-18975627 TTCTGGGTTTGATGTGTGGTTGG - Intergenic
1095561015 12:43565012-43565034 TTCTGGGTATGCTGTGAAGTAGG - Intergenic
1096386078 12:51196217-51196239 ATCTGGGTTTGGGGTGGAGCTGG - Intronic
1096519747 12:52178208-52178230 TCCTGAGCCTGCTGTGGAGAAGG - Intronic
1096813006 12:54183579-54183601 GGCTGGGTGTGCTGTGGAGAAGG - Intronic
1097900699 12:64871057-64871079 TACTGTGTGTGCTGTGGAGAAGG + Intronic
1098860982 12:75709703-75709725 TTCTGAGTTGGCTGTGTAGGGGG - Intergenic
1101605659 12:106246735-106246757 TTTTGGGTTTTCTTTTGAGAGGG - Intronic
1101709169 12:107248957-107248979 TTCTGGGCTTATTTTGGAGAGGG - Intergenic
1102297851 12:111750680-111750702 TTCTGGATGTGCTGTGGAGGAGG - Intronic
1102584075 12:113911021-113911043 ATCTGGGTTTGCTCTGGAGTAGG - Intronic
1102600863 12:114029403-114029425 TTGTGGATGTGCTGTGGAAATGG + Intergenic
1102656797 12:114488928-114488950 TTCTAAGGTTGCTGTGGGGATGG - Intergenic
1103213146 12:119180954-119180976 TTCTGAGTTGGCTGGGGAGCAGG + Intronic
1103307913 12:119980916-119980938 TTTTGGATTTTCTGTAGAGACGG + Intergenic
1103698887 12:122837487-122837509 TTTTGTGTTTGCAGTAGAGAAGG + Intronic
1104464165 12:128977139-128977161 TTCTTGTTTTGCTTTTGAGATGG - Intronic
1106283541 13:28298648-28298670 TTTTGGGTTGGCTGTCTAGAAGG + Intergenic
1106680766 13:32004701-32004723 TTTTGTGTTTCCTGTGGAGGAGG + Intergenic
1108750647 13:53444972-53444994 TTCCGTGTGTGCTCTGGAGAGGG - Intergenic
1109095426 13:58107861-58107883 GCCTGGGTATGGTGTGGAGAGGG + Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1110520656 13:76472304-76472326 TTCTGTATTTTCAGTGGAGACGG + Intergenic
1110656330 13:78004441-78004463 TTCTGGGATACATGTGGAGAAGG - Intergenic
1112497729 13:99918112-99918134 TTGTGGGCTTTCTGGGGAGAAGG + Intergenic
1112835530 13:103509626-103509648 TTCTGGGTTTTCTATGGACCAGG - Intergenic
1113627450 13:111857490-111857512 CTCTGGCTGTGCTGTGGTGAAGG + Intergenic
1113628708 13:111865401-111865423 TCCTGGGTTGGCTGCGGAAAGGG + Intergenic
1114625438 14:24126133-24126155 TTTTGTGTTTTCTGTAGAGATGG + Intronic
1114863534 14:26557541-26557563 TTTTGTATTTTCTGTGGAGACGG + Intronic
1116705833 14:48298052-48298074 TTCTGAGTTTGAGGAGGAGATGG - Intergenic
1117568722 14:57023987-57024009 TTCTGTGTTTTTTGTAGAGACGG - Intergenic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118779935 14:69001147-69001169 TTCTGTATTTGTTGTAGAGATGG + Intergenic
1121320000 14:92986696-92986718 TTCTTGTTTTGCTGGGGAGCGGG + Intronic
1121433410 14:93903197-93903219 AGGTGGGTTTGCTGTGGAGCAGG + Intergenic
1121625273 14:95380856-95380878 TTTTGGGTTTTCTGTTGACAGGG + Intergenic
1121717825 14:96088793-96088815 TTCTGTGTTTGCTGCGGTGAAGG + Exonic
1121909674 14:97777396-97777418 GTCTGGGTTGGCTTTTGAGAGGG + Intergenic
1122240583 14:100363690-100363712 TTCTGGGTTTTTTGTGGGGTGGG - Intronic
1122738788 14:103858846-103858868 TCCTGGGTTGGCTGTCCAGAGGG - Intergenic
1124892127 15:33743132-33743154 CTGTGGCTTTGCTGTGGACATGG - Intronic
1125026937 15:35040294-35040316 TGCTGGGTTTGCTTTGGAGGTGG - Intergenic
1125747729 15:42008559-42008581 TGCTGGATATGCTCTGGAGAAGG + Intronic
1125880425 15:43189187-43189209 TTCTGGGTTTCCTATGAAAAAGG - Exonic
1126969083 15:54089382-54089404 TCCTGGGTTTGCGCTTGAGATGG + Intronic
1127077207 15:55338472-55338494 TTTTGGATTTTCTGTAGAGATGG - Intronic
1127802462 15:62489154-62489176 TTCTTTGTTTGCTTTTGAGACGG - Intronic
1127966953 15:63929673-63929695 TCCAGGGTCTGCTGTGGAGGAGG - Intronic
1128370728 15:67037198-67037220 TTCTGGGTTAGGTGAGGGGAGGG + Intergenic
1128832004 15:70778028-70778050 TTTTGTGTTTTTTGTGGAGATGG - Intergenic
1128858922 15:71048263-71048285 TTCTTGTTTTTCTGTAGAGATGG + Intronic
1129330185 15:74823166-74823188 TCCTGGGGATGCTGTGGAGGAGG + Intronic
1129651208 15:77491560-77491582 TTGTGGGCTTCCAGTGGAGAGGG - Intergenic
1131020925 15:89098048-89098070 TTTTGTGTTTGTTGTAGAGATGG + Intronic
1131834741 15:96379140-96379162 TTCTTGGTCTTCTGTGGAGAGGG + Intergenic
1132411891 15:101586135-101586157 TGGTTTGTTTGCTGTGGAGATGG - Intergenic
1132823974 16:1893653-1893675 TTCTGTGTTTTTTGTAGAGATGG - Intergenic
1132832237 16:1934036-1934058 TTCTGGTTTTTCTCGGGAGATGG + Intergenic
1133060003 16:3168419-3168441 TTGTGTGTTTTCTGTAGAGATGG + Intergenic
1133688687 16:8191619-8191641 TTCTTTGTTTGTTGTTGAGACGG - Intergenic
1134076049 16:11292261-11292283 TTCTGTATTTTCTGTAGAGATGG - Intronic
1134166975 16:11938499-11938521 TTTTGTATTTTCTGTGGAGATGG + Intronic
1135717624 16:24785925-24785947 TTTTGGATTTGCTGTGCACAGGG + Intronic
1135828887 16:25755363-25755385 TTCCGGGCATGCTTTGGAGAAGG + Intronic
1135887898 16:26329005-26329027 TTCTGGGGTTTCTGGGGATATGG - Intergenic
1135997312 16:27260686-27260708 TTTTGTGTTTTTTGTGGAGATGG - Intronic
1137061110 16:35792418-35792440 TTCTGGATTTGCGGTGAAGTGGG - Intergenic
1137838801 16:51620988-51621010 TTCTTGGTTTGCTTTTGATATGG + Intergenic
1137959554 16:52868518-52868540 TTCTGGGTTTGGTGGGGACTTGG + Intergenic
1140592412 16:76369669-76369691 TTTTGTGTTTTCTGTAGAGATGG - Intronic
1141224505 16:82102193-82102215 TCCTGGGTCTGCTGTGAGGATGG - Intergenic
1141497983 16:84423283-84423305 TACTGGGTTTGTTCTGCAGATGG + Intronic
1141895811 16:86958005-86958027 GTCTGTGTTTACAGTGGAGATGG - Intergenic
1143207280 17:5152824-5152846 TTCTGTATTTTCTGTAGAGATGG - Intronic
1144380122 17:14686786-14686808 TTCTAGATTTGCTGTGCAAAAGG + Intergenic
1144761384 17:17709510-17709532 TTTTGGGGCAGCTGTGGAGAGGG - Intronic
1145449390 17:23223495-23223517 TTTTTGGTTTGTTGTGGAAAAGG + Intergenic
1146811478 17:35907322-35907344 TTCTGAGTTTTCTGGGGAGGTGG - Intergenic
1147743340 17:42680917-42680939 CTCAAGGTTTGCTGTGAAGATGG + Intronic
1147803298 17:43110413-43110435 TTTTGTGTTTTCTGTAGAGACGG - Intronic
1148003352 17:44404088-44404110 TTATTTGTTTGCTGTGGAGTAGG - Intronic
1148808204 17:50274702-50274724 TTCTCTCTTTGCTGTGGAGGTGG + Intronic
1149120113 17:53152429-53152451 GTATTGGTTAGCTGTGGAGAGGG - Intergenic
1149531378 17:57397880-57397902 TTCAGTGTTTGCTGAGGAGTGGG + Intronic
1149873071 17:60201026-60201048 TTCTGTATTTTCTGTAGAGATGG + Intronic
1149959194 17:61088727-61088749 TTGTGGTTTTACTATGGAGATGG + Intronic
1150086851 17:62278300-62278322 TTCTGTATTTTCTGTAGAGATGG + Intronic
1150901423 17:69282300-69282322 TCCTGGGTGAGCAGTGGAGAAGG - Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1152707968 17:81855086-81855108 TTCTGGGGTTGGTCTGCAGAGGG - Intronic
1152823645 17:82450109-82450131 TTATGTATTTTCTGTGGAGACGG - Intronic
1203161791 17_GL000205v2_random:59117-59139 TTCTGTGGTTTTTGTGGAGACGG - Intergenic
1153117856 18:1682808-1682830 TTCAGAGTTTGCATTGGAGAGGG + Intergenic
1153157587 18:2167027-2167049 TTGTTGGTTTGCTGGGAAGAGGG + Intergenic
1155380607 18:25218221-25218243 TTCTGGCAGTGGTGTGGAGATGG + Intronic
1155468794 18:26169150-26169172 TTCTGTGTTTTTTGTAGAGATGG + Intronic
1155491030 18:26402118-26402140 TTTTGGGTTTTTTGTAGAGATGG + Intergenic
1155786730 18:29912410-29912432 TGTTGGGTTGGCTGTGGGGATGG - Intergenic
1156030458 18:32706958-32706980 TTCTGGGTTTGGTGGGGCAATGG + Intronic
1156384385 18:36592673-36592695 GGGTGGATTTGCTGTGGAGATGG + Intronic
1157233147 18:45938288-45938310 TTTTGGGTTTGTAGTAGAGACGG - Intronic
1158408757 18:57186260-57186282 CAGTGGCTTTGCTGTGGAGATGG + Intergenic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1159829970 18:73264412-73264434 TTCTGTGTTTTCAGTAGAGACGG - Exonic
1160527396 18:79545621-79545643 ATTTGTGTTTGCTGGGGAGATGG + Intergenic
1160805744 19:991590-991612 AACTGGGTTTGCTGTGGGGTGGG + Intronic
1161317753 19:3626188-3626210 TTCTGGCTTTGAGGTGGAGAAGG - Intronic
1162316575 19:9942601-9942623 TTCTGTATTTTCTGTAGAGATGG + Intergenic
1162576091 19:11499739-11499761 TTCTGTATTTTTTGTGGAGATGG - Intronic
1162613007 19:11770757-11770779 TTTTGTGTTTTCTGTAGAGATGG + Intronic
1162613249 19:11772699-11772721 TTTTGTGTTTTCTGTAGAGATGG - Intronic
1162973183 19:14193414-14193436 TTTTGTGTTTTTTGTGGAGATGG - Intronic
1163401851 19:17098757-17098779 TTCTGTATTTTCTGTAGAGATGG - Intronic
1163706568 19:18817506-18817528 TTTTGGATTTTCAGTGGAGACGG + Intergenic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164014690 19:21242954-21242976 CTCTGGGTTTGTAGTGGAGTTGG - Intronic
1164031276 19:21408001-21408023 CTCTGGGTTTGTAGTGGAGTGGG + Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164502476 19:28831490-28831512 TTCTGTGGTTGACGTGGAGACGG - Intergenic
1165706354 19:37978965-37978987 TTCTGGTTTTGTTTTTGAGACGG - Intronic
1166517163 19:43455884-43455906 TTCAGGGCTTGCTGGGGACAAGG - Intergenic
1167111469 19:47464615-47464637 TTGTGGGTTTTCTGTGAAGGAGG - Intronic
925500351 2:4497044-4497066 TTCTGTATTTTCTGTAGAGATGG - Intergenic
925964603 2:9052343-9052365 TTCTGTGTTTTTTGTAGAGACGG + Intergenic
926336134 2:11864196-11864218 TTCAGGGTTGGCTGTGGCCAGGG + Intergenic
926690736 2:15731493-15731515 TTCTGGGTTCCCTGAGGACAGGG + Intronic
928398959 2:30964399-30964421 TCCTGGGTCTCCTGTGGTGAGGG - Intronic
929239844 2:39642979-39643001 TTCTGTATTTTTTGTGGAGATGG - Intergenic
929573072 2:43035007-43035029 TTTTGTGTTTTCTGTAGAGACGG - Intergenic
930483956 2:51988546-51988568 TTGTGTGTTTGCTGAGGAGTAGG - Intergenic
932612761 2:73211973-73211995 TCCTGGCCTGGCTGTGGAGAAGG + Exonic
933802824 2:85976659-85976681 GTGTGGGTTTTCTATGGAGAGGG - Intergenic
934769541 2:96899100-96899122 CCCTGGGCTTGCAGTGGAGATGG + Intronic
935305227 2:101730873-101730895 TTCTGCGTTTTTTGTAGAGATGG - Intronic
935514914 2:104023926-104023948 TTCTGGGTTCTCGGTGGGGATGG + Intergenic
936292361 2:111236017-111236039 GACTGGGTGTGCTGTGGAGTTGG + Intergenic
937086208 2:119173663-119173685 CACTGGGTTTCCTGTGGACACGG - Intergenic
938249751 2:129805483-129805505 TTCTGGGAAAGCTGAGGAGAAGG + Intergenic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
939936805 2:148302639-148302661 TTCTGGGTTTTCTGGAGACACGG + Intronic
940470366 2:154089848-154089870 TGGTTGTTTTGCTGTGGAGAAGG + Intronic
942334137 2:174862805-174862827 TTCTGGGTTCCCTTTAGAGATGG + Intronic
943003199 2:182356577-182356599 TTTTGTATTTTCTGTGGAGATGG - Intronic
943819329 2:192300012-192300034 TTCAGAGTTTCCTGTGGAGTTGG + Intergenic
944188325 2:196974251-196974273 TTCTGTGTTTTTTGTAGAGACGG + Intronic
944740890 2:202611507-202611529 TTGTGGGTTTTTTGTAGAGACGG - Intergenic
945407083 2:209461618-209461640 TTTTGTGTTTTCAGTGGAGACGG + Intronic
945444947 2:209925780-209925802 TTCTGGGTTGGATGTGGACTTGG - Intronic
946402401 2:219475516-219475538 TTCTGGCCGTGCTGTGAAGATGG + Intronic
947004475 2:225494748-225494770 TTTGGGGATTGCAGTGGAGAAGG + Intronic
947809357 2:232992385-232992407 TTTTGTATTTGCAGTGGAGACGG - Intronic
947832374 2:233150714-233150736 CTAAGGATTTGCTGTGGAGAAGG + Intronic
948138973 2:235659098-235659120 TTCTGGGCTTGCCCTGGGGAAGG + Intronic
948433223 2:237933967-237933989 TTCTGGGCTGACTGTGAAGATGG - Intergenic
948642604 2:239385177-239385199 TGCTGGGGATGCTGGGGAGAGGG - Intronic
948855045 2:240726173-240726195 CTCTGGGGGTGCTGTGGGGATGG + Intronic
948947519 2:241228590-241228612 TTATGGGTTTCCCGTGGAGCTGG - Exonic
1169269995 20:4191865-4191887 TTCTGTATTTTTTGTGGAGACGG - Intergenic
1169316536 20:4595709-4595731 TTCTGGTTTTGTTTTTGAGAAGG + Intergenic
1169436600 20:5598215-5598237 TTTTGTTTTTGGTGTGGAGATGG - Intronic
1169626976 20:7582056-7582078 GCCTGGGTTTACTGTGGAGGAGG - Intergenic
1169630504 20:7625852-7625874 CTCTGGGTCTGCTGTGGGGAGGG - Intergenic
1170913927 20:20604075-20604097 TCGTGGGCTTGCTGGGGAGATGG - Intronic
1171349455 20:24491551-24491573 TCCTGGGTCTGCTATGGGGATGG - Intronic
1171374039 20:24680029-24680051 TTCTGGGGTTGCAATGGAGCAGG + Intergenic
1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG + Intronic
1172588651 20:36102466-36102488 TACTGGCTTTGCTGTGAAGGTGG + Intronic
1175275331 20:57764699-57764721 TTCCAGGTTTGTTGTGGGGAGGG + Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175721106 20:61287840-61287862 TCCTGGGGTTGCTGTGGAAGAGG + Intronic
1176745088 21:10644526-10644548 TTCTGGATTTTCAGTAGAGATGG + Intergenic
1177252744 21:18616290-18616312 TTTAGGGTATGCTGTAGAGATGG + Intergenic
1178434075 21:32541988-32542010 CTCTGGGCTTGCTGTAGTGATGG + Intergenic
1178668749 21:34572095-34572117 TTCTGTGTTTGCTTCAGAGAAGG - Intronic
1179435890 21:41361824-41361846 TCCTGGGAGAGCTGTGGAGACGG - Intergenic
1179511055 21:41873873-41873895 TTTTGTGTTTTCTGTAGAGATGG - Intronic
1180854953 22:19039880-19039902 TTCTGAATTTTTTGTGGAGAAGG + Intronic
1182346244 22:29667555-29667577 TTTTGAGTTTTTTGTGGAGATGG + Intronic
1183258265 22:36777024-36777046 TTGTGGGGTGGTTGTGGAGATGG + Intergenic
1183465911 22:37980306-37980328 TTCTGGGATGGCTGGGGACATGG + Intronic
1183726416 22:39592408-39592430 CTCTGGGCTTGCTGTGGAGCTGG + Intronic
1184987334 22:48144744-48144766 TTCTGGGTCAGCTGTGGGTATGG + Intergenic
1185172247 22:49301035-49301057 TTCTGGGGTTTCTGTGGACACGG - Intergenic
949923375 3:9021901-9021923 TTTTGTGTTTTCTGTAGAGATGG - Intronic
950479028 3:13233422-13233444 TTCTGGCTGTGCTGTGGACTTGG + Intergenic
950988037 3:17397547-17397569 TTCTGTGTTTTCTGTGGAGACGG + Intronic
951076677 3:18401867-18401889 TACTGGGGTTTCTGTGAAGATGG - Intronic
952506539 3:34011524-34011546 TTCTGGGTCTACTTTTGAGATGG + Intergenic
954196459 3:48999928-48999950 TTCTGGGTTTGCTGGGGTCACGG + Intronic
954387179 3:50250151-50250173 TCCCAGGATTGCTGTGGAGATGG + Intronic
954751130 3:52814268-52814290 TTCTGGGATGGCCGTGGGGAGGG - Exonic
955651711 3:61201877-61201899 TTCTGTGTTTGAAGTGGAAAGGG - Intronic
955672164 3:61412959-61412981 TTCTGGCTATGTTGTGGAGAAGG + Intergenic
956149081 3:66222350-66222372 TTTTGGGTTTTTAGTGGAGACGG + Intronic
956289503 3:67646851-67646873 TTCTGGATATAGTGTGGAGAGGG - Intronic
956826807 3:73004606-73004628 TTTTGTGTTTTCTGTAGAGATGG + Intronic
960020110 3:112940341-112940363 TTATTGTTTTGCTGTGCAGAAGG - Intronic
960548473 3:118946108-118946130 TTCTGTGGTTGCTATGGAGAAGG - Intronic
960643079 3:119847252-119847274 TTCTGGGATACATGTGGAGAAGG - Intronic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
961010902 3:123435112-123435134 TTTTGTGTTTTTTGTGGAGATGG - Intronic
961047248 3:123718030-123718052 TTTTGTGTTTTTTGTGGAGACGG + Intronic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
962901689 3:139767170-139767192 TTCTGGGTTTGCTGAGCTGATGG + Intergenic
964171632 3:153777354-153777376 TTCATGGTAAGCTGTGGAGATGG - Intergenic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
964502332 3:157362199-157362221 TTCTGTATTTGCAGTAGAGACGG + Intronic
964655659 3:159063727-159063749 TTCATGGTTTGCTGGGGGGAAGG + Intronic
964740559 3:159960936-159960958 CTCTGTGTTTGATGTGGGGAGGG + Intergenic
964787578 3:160415199-160415221 TTTTGGATTTTCTGTAGAGATGG - Intronic
965199689 3:165641875-165641897 ATCTGGTTCTGTTGTGGAGAAGG - Intergenic
966101039 3:176269347-176269369 TTCTGGGTCAGGTGTGGGGATGG + Intergenic
966311712 3:178601521-178601543 TTCTGAGTCAGCTGTGGACAGGG - Intronic
968986370 4:3876991-3877013 TTCTGGGTTGTCTGTGGAAGAGG + Intergenic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
970032619 4:11693992-11694014 TTTTGAGTGTGGTGTGGAGAAGG + Intergenic
970232113 4:13921688-13921710 TTCTGATTTTGCTGAAGAGAGGG - Intergenic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
972230936 4:37072087-37072109 CTCTGGGTTTGAGGTGGAAATGG - Intergenic
972279850 4:37591249-37591271 TTCTGCATTTTCTGTGGATATGG - Exonic
972551235 4:40136555-40136577 TTTTGGGTTTTTTGTAGAGACGG + Intronic
973922128 4:55697965-55697987 TTTTTGTTTTGCTGTTGAGATGG - Intergenic
974899627 4:67981587-67981609 TTTTGGGTTTTTTTTGGAGATGG + Intergenic
975259606 4:72281898-72281920 TTCTGGCTTTGCTGTGAGCAAGG + Exonic
976233334 4:82868863-82868885 TTTTGTATTTGTTGTGGAGATGG + Intronic
976818734 4:89180505-89180527 TTTTGTGTTTTCTGTAGAGATGG + Intergenic
978402497 4:108345380-108345402 TTTTGAATTTTCTGTGGAGATGG - Intergenic
979689813 4:123548055-123548077 TTATGGGTTATCTGGGGAGATGG + Intergenic
979988476 4:127344540-127344562 TTGTGGTTTTCCTGTGGAGTTGG - Intergenic
981543332 4:145868748-145868770 TTCAGAGTTTGCTGTGCAGCAGG - Intronic
981855833 4:149290778-149290800 TTCTGGGATACATGTGGAGAAGG - Intergenic
982280246 4:153676765-153676787 TTTTGAGTTTTCTGTGGACAGGG + Intergenic
983626719 4:169809077-169809099 TTCTGTGTTTTTTGTAGAGATGG + Intergenic
983644144 4:169972662-169972684 TTTTGCGTTTTCTGTAGAGATGG + Intergenic
984171755 4:176368211-176368233 GTCTGGGTGTGCCGTGTAGACGG + Intergenic
984315302 4:178122118-178122140 GACTATGTTTGCTGTGGAGAAGG - Intergenic
985068002 4:186142265-186142287 TTGTCGGTTGGGTGTGGAGAAGG + Intronic
985089523 4:186349105-186349127 TTCTGCATTTTCTGTAGAGATGG + Intergenic
985116836 4:186600018-186600040 TTCTGGGTTTGCTGTTTAAAGGG + Exonic
985333628 4:188868612-188868634 TTTTTGGTTTGCTTTTGAGATGG - Intergenic
985895112 5:2744849-2744871 TTGTGGTTTGACTGTGGAGAAGG - Intergenic
986181858 5:5400536-5400558 TTCTGGGTTTTCTATGAAGTGGG - Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
986694507 5:10339818-10339840 TTCAGGGCTTGCTGTAGAAAAGG + Intergenic
988482503 5:31641658-31641680 TTTTGTGTTTTTTGTGGAGATGG + Intronic
988519013 5:31929677-31929699 TTCTGTATTTTCTGTAGAGACGG - Intronic
988912366 5:35856422-35856444 TTTTGTGTTTTCAGTGGAGACGG - Intronic
989422857 5:41260400-41260422 TTCTGGATTTACTGAAGAGAAGG - Intronic
989736223 5:44710141-44710163 TTCAGGGTTTTGTGTGGGGAAGG - Intergenic
991098961 5:62770714-62770736 TTCAGGGTTACATGTGGAGAAGG - Intergenic
991475916 5:67019277-67019299 TTCCTGGTATGCAGTGGAGATGG + Intronic
991600962 5:68350948-68350970 TTTTGTGTTTTCTGTAGAGATGG + Intergenic
991629745 5:68644700-68644722 TTTTGGTTTTGCTGTGGGCAGGG + Intergenic
992134933 5:73734814-73734836 TTGTGTTTTTGCAGTGGAGAGGG + Intronic
992367968 5:76112566-76112588 TTCTGGCTGCTCTGTGGAGAAGG + Intronic
992466527 5:77011726-77011748 GTCTGGGGTGGCTGAGGAGAAGG - Intergenic
993351375 5:86853864-86853886 TTCAGAGTTTTCTGTGGACATGG - Intergenic
993443929 5:87989171-87989193 TTTTGTGTTTTCGGTGGAGACGG - Intergenic
993626892 5:90236381-90236403 TTCTGGGTCTCCTTAGGAGAGGG + Intergenic
995064094 5:107840903-107840925 TTCTGAGTTGTCTGAGGAGAGGG - Intergenic
995429852 5:112061853-112061875 TTGAGGGCTTGCTCTGGAGAGGG - Intergenic
995889934 5:116939773-116939795 TTCTGGGTCTGATGTCAAGAGGG - Intergenic
996064800 5:119068825-119068847 TTCTGTATTTTCTGTAGAGACGG + Intronic
996932576 5:128908182-128908204 TCCTGGGTTTGGGGTGGGGAGGG - Intronic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997126465 5:131232282-131232304 TTTTGTGTTTTTTGTGGAGACGG + Intergenic
997554798 5:134786672-134786694 TTCTGTGTTTTCAGTAGAGACGG - Intronic
998208882 5:140178770-140178792 TTTTGTGTTTTTTGTGGAGATGG + Intronic
998349882 5:141493654-141493676 TTCTGGGGCTGCCATGGAGAAGG - Intronic
998473511 5:142401596-142401618 TTCTGTATTTGCTGTAGAGAGGG - Intergenic
998473936 5:142405180-142405202 TTCATGGTCTGCTGTGGTGATGG + Intergenic
999581968 5:153049023-153049045 TTGTGGGTTTTCAGTGGACAGGG - Intergenic
1000105869 5:158058251-158058273 TCCTGGGTTCTCTGTGGAGTTGG + Intergenic
1000115636 5:158150981-158151003 TTATGGACTTGCTGTTGAGATGG - Intergenic
1000263061 5:159608155-159608177 TTCTGTATTTTCTGTAGAGATGG - Intergenic
1001819414 5:174698401-174698423 TGCTGGGCTTGGTGAGGAGAAGG - Intergenic
1002703328 5:181142781-181142803 TTCGTGGGTTGCTGGGGAGAGGG - Intergenic
1003026655 6:2560925-2560947 ATCTGTTTTTCCTGTGGAGATGG - Intergenic
1003653361 6:7982987-7983009 TTTTGGGTTTTCAGTAGAGATGG - Intronic
1004087273 6:12462588-12462610 TTTTGTGTTTTCAGTGGAGACGG - Intergenic
1005133769 6:22542757-22542779 TTCTGGTTTCTCTGTGGAAAGGG + Intergenic
1005760270 6:28961244-28961266 TGCTGCGGTTGCTGTGGAGGAGG - Intergenic
1007040514 6:38717024-38717046 TTTTGGTTTTTCTGTAGAGATGG - Intronic
1007389809 6:41544566-41544588 TTGTGGGTTAGCTGAGGGGAAGG - Intergenic
1007462766 6:42030377-42030399 TTCTGGTTGTTCTGTGGAGCTGG + Intronic
1008021540 6:46583810-46583832 TTCTGTGTTTGCTTGTGAGAGGG + Intronic
1010110688 6:72226411-72226433 TTGTGGGTTTGCTTTGAAAAGGG - Intronic
1010666887 6:78641543-78641565 TTCTGGGTTACATGTGCAGAAGG + Intergenic
1010732781 6:79408883-79408905 TTCTCGGTTTGCAGAGCAGAGGG + Intergenic
1011196959 6:84791333-84791355 TTCTGGGGTGGCTGTGTAAAGGG + Intergenic
1011610411 6:89145899-89145921 TTTTGGGGGTGCTGTGGAGAAGG - Intergenic
1011955719 6:93022816-93022838 TTCTGGGTTTAGTGTGGATTAGG + Intergenic
1012164769 6:95935102-95935124 TTTTGGTTTTCATGTGGAGACGG - Intergenic
1014143339 6:117968956-117968978 TCCTAGTTTTGCTCTGGAGAAGG + Intronic
1014403462 6:121019664-121019686 TTCTCAATTTGCAGTGGAGATGG - Intergenic
1014999117 6:128192647-128192669 TTCTGTATTTTTTGTGGAGATGG - Intronic
1015789414 6:136951386-136951408 TTTTGTATTTTCTGTGGAGATGG + Intergenic
1016551078 6:145280969-145280991 TTCTGGGTTACATGTGCAGAAGG - Intergenic
1016939644 6:149473675-149473697 TGCTGGGGTTGCTGGGGAGGCGG - Intronic
1017112335 6:150944274-150944296 TTTTGAATTTTCTGTGGAGATGG - Intronic
1017495604 6:154980472-154980494 TTCTGTATTTGTTGTAGAGAGGG - Intronic
1017615983 6:156246921-156246943 CTCTGGGCTTGCTGTAGTGATGG + Intergenic
1018665141 6:166128251-166128273 ATCTGGGTTTGCTGCAGAGAGGG - Intergenic
1018665156 6:166128338-166128360 GTCTGGGTTTGCTGCAGAGAGGG - Intergenic
1018887284 6:167950740-167950762 GTCTGGCTCTGCAGTGGAGATGG + Intronic
1018929490 6:168231173-168231195 TTCGGGGCTTGCTGTGGTGGGGG - Intergenic
1020207531 7:6130588-6130610 TACTGGGTTAACGGTGGAGAAGG - Intronic
1020217749 7:6207777-6207799 TTTTGTATTTGTTGTGGAGATGG - Intronic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1021936452 7:25636750-25636772 TCCTGGCCTTGCTGTGGAGGTGG + Intergenic
1022379744 7:29848471-29848493 TTCTTTCTTTGCTTTGGAGAGGG - Intronic
1022422868 7:30240541-30240563 TTCATGGTTTGCTGGGCAGAAGG + Intergenic
1023427974 7:40059236-40059258 TGCTTGGTTTGTTGTGGATACGG + Intronic
1023843746 7:44109951-44109973 TTCTGGGTTTGGTGGAGGGAAGG + Intronic
1024867561 7:53921061-53921083 TTCTGGGTTTGGTGGGGACTTGG + Intergenic
1025083791 7:56006290-56006312 TTTTTGTTTTTCTGTGGAGACGG + Intergenic
1025159861 7:56647108-56647130 TTTTGGGTATGCAGTGGAGAGGG - Intergenic
1025164164 7:56695986-56696008 TTTTGGGCTTGCAGTGGAGATGG - Intergenic
1025706118 7:63866085-63866107 TTTTGGGCTTGCAGTGGAGATGG + Intergenic
1025726858 7:64072228-64072250 TTTTGGGTATGCAGTGGAGAGGG + Intronic
1025755848 7:64339932-64339954 TCTTGGGTATGCAGTGGAGAGGG + Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025804398 7:64816855-64816877 CTCTGGGTTTGTAATGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026117285 7:67506574-67506596 CTATGGGGTTGCTGGGGAGAGGG + Intergenic
1027171493 7:75876044-75876066 TTCTGCATTTGCTGTGCAGAGGG - Intronic
1027950728 7:84811572-84811594 TTCTGGGTTAGCTGGTGGGATGG - Intergenic
1028085124 7:86626633-86626655 TTCTGGTTTTACTTTGAAGATGG + Intergenic
1028677427 7:93481595-93481617 TTTTGGGTTAGATTTGGAGATGG + Intronic
1029335995 7:99899795-99899817 TTCTGGGTTTTCTTTTGAGATGG + Intronic
1029505416 7:100960906-100960928 TTGTGAGTTTGCTGTGGAACAGG + Exonic
1029925948 7:104317021-104317043 TTCTATTTTTGCTGTTGAGATGG - Intergenic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1032131935 7:129236509-129236531 TTCTGTGTTTTTTGTAGAGATGG + Intronic
1032197107 7:129795754-129795776 TTCTTGGTTTGTTTTTGAGACGG + Intergenic
1032477927 7:132225024-132225046 TTGTGGGGCTTCTGTGGAGAGGG + Intronic
1032823119 7:135543067-135543089 TTGTCTGTTTGCTGTGGAGGTGG - Intergenic
1033666824 7:143448859-143448881 TTTTGAGTTTTCTGTAGAGAAGG - Intergenic
1034048856 7:147960096-147960118 TGCTGGGCTTGCTGTGGGAATGG - Intronic
1034185081 7:149169620-149169642 TTTTGTATTTTCTGTGGAGATGG + Intronic
1034230332 7:149520668-149520690 TTCTGGCAAGGCTGTGGAGAAGG + Intergenic
1034336422 7:150326510-150326532 TTTTGTGTTTTCTGTAGAGACGG - Intronic
1034691122 7:153014615-153014637 TTTTGGATTTGCAGTAGAGATGG + Intergenic
1035165425 7:156986702-156986724 TTCTGTATTTTCAGTGGAGACGG - Intergenic
1035321088 7:158029645-158029667 TACTGTGTTTGCTGTGTGGATGG - Intronic
1035321113 7:158029779-158029801 TGCTGTGTTTGCTGTGTGGATGG - Intronic
1036215074 8:6872593-6872615 TTTTTGTGTTGCTGTGGAGATGG + Intronic
1036542556 8:9731597-9731619 TTGTGTGTGTGCTGTGGCGATGG + Intronic
1036952435 8:13154139-13154161 TTCTGGGTCTGCTGGGGACTTGG - Intronic
1037269992 8:17116013-17116035 TTCTGTGTTTAGTGTGGAGCAGG - Intronic
1038149873 8:24933133-24933155 TATTGGCATTGCTGTGGAGATGG - Intergenic
1038276120 8:26122277-26122299 TCCTATGGTTGCTGTGGAGACGG - Intergenic
1039193517 8:35003815-35003837 TTTTGATTTTGCTGGGGAGAAGG - Intergenic
1040395790 8:46998976-46998998 TTCAGGGTTGGTTGTGGAGAAGG + Intergenic
1040418716 8:47219471-47219493 CTCTTGGTTTGCTGGGGACAGGG + Intergenic
1040482338 8:47837482-47837504 TACAGGGTGTCCTGTGGAGAAGG + Intronic
1041060875 8:54033209-54033231 TTTTGTGTTTTCTGTAGAGATGG - Intergenic
1042354352 8:67809912-67809934 TTTTAGGATTGCTGTGAAGATGG + Intergenic
1042905197 8:73765517-73765539 TTGTGGGTTTTTTGTAGAGATGG + Intronic
1043451739 8:80374741-80374763 TTTTGTGTTTGCTGAAGAGACGG + Intergenic
1043836128 8:85049010-85049032 TCCTGGGTTTGCTAGGGGGAAGG - Intergenic
1045029186 8:98118594-98118616 TTTTGTATTTTCTGTGGAGACGG + Intronic
1045032515 8:98151250-98151272 TTCTGTATTTTCTGTAGAGACGG + Intronic
1045943922 8:107773029-107773051 TTCTTGGTTTGCTTTGGATGGGG - Intergenic
1046777053 8:118175535-118175557 TTCTCTGTTTACTGTGCAGATGG - Intergenic
1047188794 8:122659490-122659512 TTCTAGGCTTGCTGGGGAAAAGG - Intergenic
1047653343 8:126948444-126948466 TTTTGTGTTTTTTGTGGAGATGG - Intergenic
1049048223 8:140169906-140169928 TTCTGCATTTTCTGTAGAGACGG + Intronic
1049648414 8:143749731-143749753 TTTTGTGTTTTTTGTGGAGATGG + Intergenic
1049784972 8:144446142-144446164 TGCTGGGTGTGCTGTGTAGCCGG - Intergenic
1049968084 9:797415-797437 TTTTGTATTTGTTGTGGAGATGG - Intergenic
1051622916 9:19070104-19070126 TTCTGGGTCTGTTGGGGAGTTGG - Intronic
1051678375 9:19581443-19581465 TTCTGGGCCTGAGGTGGAGAGGG - Intronic
1052190196 9:25652615-25652637 TTGTGGGTTTTCTGTAGAGATGG - Intergenic
1052608914 9:30743870-30743892 GTGAGGGTTTGCTGAGGAGAGGG + Intergenic
1052964054 9:34325520-34325542 TTCTGTATTTTTTGTGGAGATGG - Intronic
1052987273 9:34496831-34496853 TTCTGGACTTGTTTTGGAGAAGG - Intronic
1055111664 9:72566192-72566214 TTGTTTGTTTGTTGTGGAGATGG + Intronic
1056358726 9:85830464-85830486 TTCTGATTTTTTTGTGGAGACGG + Intergenic
1056839866 9:89990094-89990116 TTCCGGGTTTGATGTGGGCACGG + Intergenic
1057593617 9:96395341-96395363 CTCTGGGATTGCTGTGCAGGGGG - Intronic
1057767341 9:97933895-97933917 TTCTGGGCTTGCTGGGCTGAGGG - Intronic
1057784324 9:98075133-98075155 TTTTTAATTTGCTGTGGAGATGG - Intronic
1058670669 9:107358189-107358211 TCCTGTGTTTTCTGTGGGGAGGG + Intergenic
1059037849 9:110777687-110777709 TTGAGGGTTTGCTGTGTGGAAGG + Intronic
1059303432 9:113334174-113334196 TTCTGTGTTTTTTGTAGAGACGG + Intronic
1059390571 9:113997276-113997298 TTTTGTGTTTTCTGTAGAGATGG + Intronic
1060850901 9:126874518-126874540 TTTGGGGTATGCTGTGAAGAAGG + Intronic
1061013238 9:127967593-127967615 CTCTGTGTTTGCTGTGGGCATGG - Intronic
1061244244 9:129393120-129393142 TGCTGGGGTTGATGTGGAGGAGG - Intergenic
1061786226 9:133030270-133030292 TTCGGGGCTTTCTGTGGAGGCGG + Intergenic
1062682761 9:137791197-137791219 TGACGGGTTTGCTGTGCAGAAGG + Intronic
1186192165 X:7076616-7076638 TGCAGGGTATGCAGTGGAGACGG - Intronic
1187153525 X:16703195-16703217 TTGTGGGTTTTTTGTAGAGACGG + Intronic
1189906980 X:45771224-45771246 TTCTGGGCTTGCCTGGGAGAAGG - Intergenic
1190584686 X:51927370-51927392 TTCTGGGATAACTGTGCAGAAGG + Intergenic
1190587321 X:51959521-51959543 TTCTCGGTCTGTTGTGGAGTGGG - Intergenic
1190702895 X:53001280-53001302 TTCTGTTTTTGCTTTTGAGATGG + Intergenic
1191987520 X:66998249-66998271 TTATTGTTTTGCTGGGGAGAGGG + Intergenic
1192851236 X:74958362-74958384 TTCTGGTTTAGCTGGGGAGAGGG + Intergenic
1193886821 X:86993240-86993262 TGCTGCTTTTGCAGTGGAGATGG - Intergenic
1194177583 X:90669757-90669779 TTCTGTGTCTGCTGTTTAGAAGG - Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1199944715 X:152656098-152656120 TTCTGAGTTTGCTATGGATTTGG + Exonic
1200524253 Y:4251892-4251914 TTCTGTGTCTGCTGTTTAGAAGG - Intergenic
1201310639 Y:12595735-12595757 TTCTGAGTTTTCTTTGGGGAAGG + Intergenic