ID: 961566645

View in Genome Browser
Species Human (GRCh38)
Location 3:127768781-127768803
Sequence ATCACTCATGTGTCTACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961566637_961566645 16 Left 961566637 3:127768742-127768764 CCAAGCCCCAGTGCTCACCTCTT 0: 1
1: 1
2: 4
3: 40
4: 408
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566633_961566645 29 Left 961566633 3:127768729-127768751 CCCCTCCAGCTCTCCAAGCCCCA 0: 1
1: 0
2: 7
3: 90
4: 641
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566640_961566645 10 Left 961566640 3:127768748-127768770 CCCAGTGCTCACCTCTTTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566636_961566645 24 Left 961566636 3:127768734-127768756 CCAGCTCTCCAAGCCCCAGTGCT 0: 1
1: 1
2: 4
3: 42
4: 413
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566634_961566645 28 Left 961566634 3:127768730-127768752 CCCTCCAGCTCTCCAAGCCCCAG 0: 1
1: 2
2: 9
3: 65
4: 668
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566642_961566645 9 Left 961566642 3:127768749-127768771 CCAGTGCTCACCTCTTTCAGGGA 0: 1
1: 0
2: 0
3: 21
4: 203
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566638_961566645 11 Left 961566638 3:127768747-127768769 CCCCAGTGCTCACCTCTTTCAGG 0: 1
1: 0
2: 0
3: 20
4: 268
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566643_961566645 -1 Left 961566643 3:127768759-127768781 CCTCTTTCAGGGAACCTAGCGCA 0: 1
1: 0
2: 2
3: 5
4: 81
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
961566635_961566645 27 Left 961566635 3:127768731-127768753 CCTCCAGCTCTCCAAGCCCCAGT 0: 1
1: 2
2: 4
3: 57
4: 606
Right 961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961566645 Original CRISPR ATCACTCATGTGTCTACCCC TGG Intronic
903539358 1:24088131-24088153 CTCACTCATCTGTCTCACCCTGG - Intronic
903925655 1:26828804-26828826 AACACTCATGTGGCCAGCCCAGG - Intronic
910480186 1:87650227-87650249 ATCACTCTAGTTTCTCCCCCAGG - Intergenic
911927928 1:103860242-103860264 ATAACTCATCTGTTTACCCATGG - Intergenic
912761173 1:112368824-112368846 ATCATTCATGAGGCTCCCCCAGG + Intergenic
913116308 1:115700806-115700828 ATTAATCATGTGTCTTCCCTGGG + Exonic
916505887 1:165427959-165427981 CTCACTCATATGTCTACCTTAGG - Intronic
923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG + Intronic
923400535 1:233612090-233612112 TTCATTCATGAGGCTACCCCCGG - Intergenic
1071403859 10:85308488-85308510 ATCATTTAAGTGTCTACCTCAGG - Intergenic
1073527934 10:104203220-104203242 CTGAATCACGTGTCTACCCCGGG - Intronic
1074182293 10:111076086-111076108 GATACTCGTGTGTCTACCCCTGG - Intergenic
1083301684 11:61742853-61742875 ATCACTCATGAGCCTGCCCCAGG - Intronic
1084454511 11:69260318-69260340 TTCACTTATCTGTTTACCCCAGG + Intergenic
1084605260 11:70168473-70168495 ATCCCTCTTCTGTCTCCCCCCGG + Intronic
1099871563 12:88355958-88355980 CTCACTCATGTGACTGCACCTGG + Intergenic
1100756223 12:97753623-97753645 ATCATTCATGTTTCTTCCTCAGG + Intergenic
1101435039 12:104657371-104657393 ATCAATCATGTCTCTCACCCAGG - Intronic
1104669401 12:130670119-130670141 ATCACTCCAGTGTCTGCCCCCGG - Intronic
1119091149 14:71782456-71782478 TTCTCTCATGAGTGTACCCCTGG + Intergenic
1124639753 15:31390236-31390258 ATCACTCAAGAGTCAATCCCAGG + Intronic
1132056338 15:98652319-98652341 TTCAGTCATCTTTCTACCCCAGG + Intronic
1136067605 16:27769356-27769378 ATCACTCCTTTTTCAACCCCTGG - Intronic
1139675286 16:68519333-68519355 ATCACTGAGATCTCTACCCCAGG + Intergenic
1152191442 17:78890601-78890623 ATCAGTGATGTATTTACCCCGGG + Exonic
1153788558 18:8556677-8556699 CTCACTCATGTGTCCACCAGTGG + Intergenic
1153998896 18:10466602-10466624 ATAACTCATGTGACTTCACCAGG + Intronic
1156700743 18:39821383-39821405 ATCAGTCATCTGTCCACTCCTGG + Intergenic
1158583695 18:58708893-58708915 ATCACTAACATTTCTACCCCAGG - Intronic
1160321729 18:77902494-77902516 ATGACTCAGGTGTCGACCCCAGG - Intergenic
1160978690 19:1806672-1806694 GTCACTCTTGTGTCTCCCCTGGG + Exonic
1164907843 19:31981994-31982016 ACCACCCATGTGCCAACCCCTGG - Intergenic
1164925052 19:32124039-32124061 ATCCCTCATCAGTCTACCCTGGG - Intergenic
1165562273 19:36689862-36689884 ATCACTCACGTTTTTCCCCCTGG + Intronic
926349019 2:11978428-11978450 TACATTCATGTGTCTTCCCCAGG + Intergenic
936687358 2:114843292-114843314 ATTACTCATGTTTCTACCAGTGG + Intronic
939315198 2:140539647-140539669 ATCACTCATGTTTCTTTCACAGG - Intronic
941201643 2:162518533-162518555 CTCACTCCTGTGTCTATCCCTGG - Intronic
943371002 2:187015724-187015746 CTCAGTCATGTGTCCACCACTGG - Intergenic
945273452 2:207964408-207964430 AGCACCAGTGTGTCTACCCCAGG - Intronic
947396439 2:229691781-229691803 CTCAGTCATGTGTCCACCACTGG - Intronic
949018606 2:241727778-241727800 TTCACACCTGTGGCTACCCCTGG + Exonic
1168797133 20:618553-618575 TTCACTCATGTGTCTGTTCCTGG - Intergenic
1169211487 20:3768255-3768277 ATCACTCCTGTTTCGACCCCAGG + Intronic
1172692852 20:36802513-36802535 ATGAGTCATGTGCCCACCCCTGG - Intronic
1173669306 20:44786703-44786725 CTCACTCATCTTTCTATCCCTGG + Intronic
1174384039 20:50176145-50176167 GTCACTTGGGTGTCTACCCCAGG + Intergenic
1175421261 20:58835392-58835414 ATGATTCATCTGTCTCCCCCAGG + Intergenic
1175945866 20:62558479-62558501 AGGCCTCCTGTGTCTACCCCAGG + Intronic
1177392782 21:20498369-20498391 ATGACTCAAGTGCCTCCCCCTGG + Intergenic
1179374227 21:40835179-40835201 ATTACTCATGAGTCTAACACAGG + Intronic
1179810683 21:43867129-43867151 ATCAGTCACGTGTCTACGGCAGG - Intronic
1180620733 22:17159920-17159942 TTCACCCTTGTGTCTACTCCGGG - Intronic
1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG + Intronic
1185200727 22:49502838-49502860 GTCACTCCTTTGCCTACCCCTGG - Intronic
950662579 3:14475797-14475819 CTGACTCATGTGTCTGCCGCAGG - Intronic
951465651 3:22997965-22997987 ACAACTCATGTGTCTGCCCTTGG + Intergenic
955438361 3:58928951-58928973 CTTCCTCATGTTTCTACCCCTGG - Intronic
961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG + Intronic
968266023 3:197364044-197364066 CTCACTCATTTGTCTGCACCAGG - Intergenic
968959017 4:3733431-3733453 AGCACTCCTGTGTCCACACCTGG - Intergenic
971935996 4:33148327-33148349 ATTAATCATGTGTGTACCCTAGG + Intergenic
974916489 4:68184121-68184143 GTCACTCACGTGTAGACCCCTGG + Intergenic
975704774 4:77100944-77100966 CTGAATCAGGTGTCTACCCCTGG + Intergenic
976551528 4:86401965-86401987 TCTAGTCATGTGTCTACCCCTGG - Intronic
981822554 4:148902726-148902748 ATCACACATGTGTCAGTCCCTGG + Intergenic
986981515 5:13453322-13453344 TTCACTAATGTGACTACACCTGG - Intergenic
987020021 5:13860605-13860627 CTCACTCATCTGTCTTTCCCAGG - Intronic
990430108 5:55726218-55726240 ATCACTCATCTGTGTTGCCCAGG + Intronic
991135151 5:63174386-63174408 ATTACTAATGTGTCTATCACTGG + Intergenic
996692493 5:126355520-126355542 ACCACACTTGTTTCTACCCCTGG - Intergenic
997816993 5:137028603-137028625 CTCACTGATCTCTCTACCCCAGG - Intronic
1000764950 5:165275960-165275982 CTTACTCATGTGTCTACTCCCGG + Intergenic
1001791756 5:174463763-174463785 CTTCCTCATGTGTCCACCCCTGG + Intergenic
1008159675 6:48061865-48061887 ATCACTCAAGTCTCCTCCCCAGG - Intronic
1017552486 6:155523895-155523917 ATCATCCATGTCTCTCCCCCGGG - Intergenic
1019379463 7:713293-713315 CACACTCACCTGTCTACCCCCGG + Intronic
1032807020 7:135365687-135365709 TTCAATCATGGGTCTTCCCCTGG - Intronic
1036716363 8:11127813-11127835 GCCATTAATGTGTCTACCCCAGG + Intronic
1039128369 8:34230686-34230708 TTCACTCATGTGTCTACTACTGG + Intergenic
1043497721 8:80821336-80821358 ATCTCACATGTGTCTGCCCCAGG - Intronic
1048973175 8:139656505-139656527 CTCACTCATCTGTCTGCACCTGG - Intronic
1051014764 9:12461466-12461488 ATTAATCATGTGGCTACCCGGGG + Intergenic
1054878581 9:70121991-70122013 GTCATTCAGGTGTCTGCCCCAGG - Intronic
1057217340 9:93236331-93236353 TTCACTCCTGTGTCTGCCCCAGG + Intronic
1059656680 9:116363898-116363920 AGCACTCTTGTGTTTAGCCCAGG + Intronic
1061177246 9:129005125-129005147 ATCTCTCCTGTGTCTCTCCCAGG + Exonic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062365328 9:136205479-136205501 ATCACGCATGGGGCTGCCCCGGG - Intergenic
1191244449 X:58214873-58214895 GTCACCCATGTGTCTACCATTGG - Intergenic
1192723803 X:73727040-73727062 TTCATTAATATGTCTACCCCAGG - Intergenic
1194318826 X:92417120-92417142 ATCACTCATTTGTCTACAGATGG - Intronic
1196941780 X:120784380-120784402 ATAACTCCTGTGCCTACCTCAGG - Intergenic
1199657033 X:150006354-150006376 ATCACTCATCTGCCTATCCATGG + Intergenic