ID: 961567973

View in Genome Browser
Species Human (GRCh38)
Location 3:127777015-127777037
Sequence AAAGCTATGCCCTTAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961567967_961567973 18 Left 961567967 3:127776974-127776996 CCTAAAGGAATAGTTCCCACGCA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 961567973 3:127777015-127777037 AAAGCTATGCCCTTAGAGAGGGG 0: 1
1: 0
2: 2
3: 11
4: 114
961567969_961567973 3 Left 961567969 3:127776989-127777011 CCCACGCAGGATAATACATGCTA 0: 1
1: 0
2: 0
3: 5
4: 49
Right 961567973 3:127777015-127777037 AAAGCTATGCCCTTAGAGAGGGG 0: 1
1: 0
2: 2
3: 11
4: 114
961567966_961567973 24 Left 961567966 3:127776968-127776990 CCTTGGCCTAAAGGAATAGTTCC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 961567973 3:127777015-127777037 AAAGCTATGCCCTTAGAGAGGGG 0: 1
1: 0
2: 2
3: 11
4: 114
961567970_961567973 2 Left 961567970 3:127776990-127777012 CCACGCAGGATAATACATGCTAT 0: 1
1: 0
2: 0
3: 6
4: 47
Right 961567973 3:127777015-127777037 AAAGCTATGCCCTTAGAGAGGGG 0: 1
1: 0
2: 2
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961567973 Original CRISPR AAAGCTATGCCCTTAGAGAG GGG Intronic
903084179 1:20840041-20840063 GTTGCTATTCCCTTAGAGAGTGG + Intronic
904205000 1:28848524-28848546 AAATCTGTGACCTTAGGGAGGGG - Intronic
904387626 1:30154621-30154643 AGAGCTTAGTCCTTAGAGAGAGG + Intergenic
904946371 1:34201648-34201670 AAATATATGTCCTTAGGGAGGGG + Intronic
917929847 1:179815665-179815687 TTAGCTATGCCCTTAGAAGGGGG - Exonic
919884356 1:201922005-201922027 AAATCCATGCCCTTTGAGATTGG + Intronic
922748555 1:228060346-228060368 AAAGCCAGGCGCTTGGAGAGGGG - Exonic
923483549 1:234407269-234407291 GAAGCTCTGCCCTGAGGGAGGGG - Intronic
1065372291 10:24999723-24999745 GAAGCTCTGCCCTAAGAAAGAGG + Intronic
1070001267 10:72379502-72379524 AAGGCTGTGCCCTGAGAGAATGG - Intronic
1075402939 10:122173852-122173874 AGAGCTGTGCCCCCAGAGAGGGG - Intronic
1075791396 10:125086853-125086875 AAAGCCAGGCCCTCAGGGAGGGG + Intronic
1078473409 11:11609939-11609961 AAAGCTGTGGCCTGAGTGAGTGG + Intronic
1086561065 11:88170030-88170052 AAAGCTAAGGCATTTGAGAGTGG - Intronic
1088141293 11:106620150-106620172 AAAGATATGCCCATATAAAGGGG + Intergenic
1089379435 11:118017061-118017083 AAACCCAGGCCCTTAGAGAAAGG + Intergenic
1089814885 11:121163719-121163741 TAAGACATGCCCTTAGATAGAGG - Intronic
1090404166 11:126467256-126467278 AAATCCCTGCCCTTAGGGAGGGG - Intronic
1091125232 11:133089565-133089587 AATTATGTGCCCTTAGAGAGTGG - Intronic
1093636755 12:21480071-21480093 ATAAATATGCCATTAGAGAGTGG + Intronic
1094522695 12:31209667-31209689 CAAGCTATGCCCTTAGATCAAGG + Intergenic
1094743999 12:33322252-33322274 AAAGCTATGCACTTAGAATGAGG + Intergenic
1100131318 12:91497315-91497337 AAAGCTATGTCCTAAGATAAAGG + Intergenic
1104796285 12:131521604-131521626 ACAGCTCTGCCCTGGGAGAGGGG + Intergenic
1109212429 13:59549076-59549098 AAAGCTATGCCCTAAGACTCTGG + Intergenic
1112659606 13:101492546-101492568 GGAGCTATGCCCTAAGAGGGTGG + Intronic
1115074117 14:29364520-29364542 AAAGCTATACCCTTGGAAAGAGG + Intergenic
1119816573 14:77574213-77574235 ATATCTATGCCCTTATAGAGTGG + Intronic
1119933566 14:78570203-78570225 AAATCCATGCCCTTAGAAAAAGG + Intronic
1120177664 14:81312323-81312345 AAAGCTAAACACTTAGGGAGAGG + Intronic
1120706511 14:87751530-87751552 AAAGCGATGCAATTAGAAAGTGG + Intergenic
1122354282 14:101113879-101113901 AAAGCTCTGGCCTTCGAGAGTGG - Intergenic
1125809881 15:42529253-42529275 GAAGCACTGCCCTAAGAGAGAGG - Intronic
1125970847 15:43910309-43910331 AAAACTATGCCATCAGAGACTGG + Intronic
1127712173 15:61610297-61610319 AAAGCAAACCTCTTAGAGAGCGG - Intergenic
1129700746 15:77767275-77767297 TAAGCAATGACTTTAGAGAGAGG + Intronic
1133851677 16:9510474-9510496 AAATTTGTGCCCTTAGAGAGAGG + Intergenic
1134874732 16:17687850-17687872 AAGGCTATGCACTTAGATAGAGG + Intergenic
1137866224 16:51899343-51899365 AAGACTATGCCCTCAGTGAGAGG - Intergenic
1141034129 16:80613104-80613126 TAAGCTATGGCTTTTGAGAGTGG - Intronic
1141533720 16:84664362-84664384 ATAGCTTTGACCTTGGAGAGAGG + Intronic
1149704966 17:58686766-58686788 AAAGCTATGCCTTTATTCAGAGG + Intronic
1150819053 17:68420275-68420297 GAAGCTGTGCCCCTAGAAAGAGG + Exonic
1152076859 17:78165097-78165119 AAAGCCATGGCCTTGGAGAGGGG - Intronic
1152162206 17:78675841-78675863 AGAGCTCTGCCCTGTGAGAGAGG + Exonic
1153014874 18:574448-574470 AAAGCTATCCCCTGAGATACAGG - Intergenic
928026081 2:27740041-27740063 AAAAATATTCCCTTTGAGAGAGG + Intergenic
933598949 2:84310071-84310093 CAGGCTATACCTTTAGAGAGAGG - Intergenic
936510566 2:113141939-113141961 AAAGCTCTGCCCTTCTGGAGTGG - Intergenic
942537557 2:176981397-176981419 CAGGCTATACCCTTAGAGATAGG + Intergenic
942874758 2:180781974-180781996 AAAGCTATACCCTAATAGATTGG - Intergenic
942998586 2:182296525-182296547 ATTGCTATGCCCTTAGGGAAAGG - Intronic
943641675 2:190365735-190365757 AAAGCTGTGCACTTAGATTGAGG - Intronic
945655633 2:212619753-212619775 AAAGAAAGGCCCTAAGAGAGTGG + Intergenic
948748494 2:240112913-240112935 AATGCCATGGCCTTAAAGAGAGG + Intergenic
1169017449 20:2303452-2303474 AAAGCTCTGCCACTAGATAGTGG + Intronic
1170304689 20:14925346-14925368 AAAACTCTGCCCTCAGATAGTGG + Intronic
1171172124 20:23024621-23024643 AAAGCTATGCATGTGGAGAGGGG + Intergenic
1173354305 20:42272663-42272685 AAAGCATTGTCCTTAGATAGTGG - Intronic
1174309626 20:49641689-49641711 AAAAGTGTGCCCATAGAGAGAGG + Intronic
1175447831 20:59036989-59037011 AGTGCTATCCCCTTAGAGATAGG + Intronic
1175636673 20:60590161-60590183 AAGGCTTTGCCATTTGAGAGGGG - Intergenic
1178480324 21:32974632-32974654 AAAGCTATGTCCTTGGGGAAGGG + Intergenic
951634254 3:24755754-24755776 GAAGCTATGGCCTTCCAGAGAGG - Intergenic
952072640 3:29657133-29657155 AGAGCTCTGCCCTAAGAAAGGGG + Intronic
954578402 3:51689690-51689712 AAACCTCTGTCCTAAGAGAGGGG + Intronic
954883550 3:53852470-53852492 AAAGCTATGCCCTTTGTTTGGGG + Intronic
957525850 3:81378154-81378176 ATAACTGTGCCTTTAGAGAGTGG - Intergenic
959575444 3:107928099-107928121 AATCCTTAGCCCTTAGAGAGAGG + Intergenic
961567973 3:127777015-127777037 AAAGCTATGCCCTTAGAGAGGGG + Intronic
962665316 3:137648400-137648422 AAATTTATGCCTTTACAGAGAGG + Intergenic
963932015 3:151013065-151013087 GAAGCTAAGCTCTGAGAGAGGGG - Intergenic
965281297 3:166757071-166757093 AAAACTTTGTACTTAGAGAGAGG + Intergenic
965685437 3:171297276-171297298 GATGCCATGCCCATAGAGAGGGG + Intronic
967800839 3:193657750-193657772 CAGGCTTTGCCATTAGAGAGGGG - Intronic
968376140 4:43230-43252 AAATCTATGGCCTCTGAGAGTGG - Intergenic
969505701 4:7586064-7586086 AGAGCAATGCCTTTAGAGTGAGG - Intronic
969680156 4:8638876-8638898 AAAGCTCTGCAGTTAGAGAGTGG + Intergenic
969795065 4:9521187-9521209 AAAGGTATGCCCTTCCAAAGTGG - Intergenic
969877422 4:10146113-10146135 AGAGCTATGAGCTTTGAGAGGGG + Intergenic
974235556 4:59176937-59176959 AAAGCTATGCCTTTAGGAGGAGG + Intergenic
974735839 4:65930794-65930816 TAAGCTATGCTTTTGGAGAGTGG + Intergenic
974873760 4:67676516-67676538 AGAGCTATGCCCTCAGTGAAAGG - Intronic
976148386 4:82066868-82066890 GAAGCTATGCCTTTCAAGAGAGG + Intergenic
978327074 4:107571351-107571373 ATAGATATGCCTTTAGAAAGAGG + Intergenic
979937459 4:126715819-126715841 AAAGCTATGGCCTTAGGGAGAGG + Intergenic
983955081 4:173688025-173688047 AATGCTATTCCCTGAGATAGCGG + Intergenic
986627545 5:9736740-9736762 AAAGAAATGTCCTTATAGAGAGG - Intergenic
987465968 5:18272457-18272479 AAAGTTATGCTATTAGAAAGTGG - Intergenic
991126654 5:63077285-63077307 AAAGGTATACCCTTAGAAACAGG + Intergenic
992227110 5:74629601-74629623 CAAGCTCTGTCCTCAGAGAGAGG + Exonic
992705286 5:79385047-79385069 AAAGCTTTTCCCTCAGAGATAGG + Intronic
994861940 5:105207884-105207906 AAGGCTGTGCCCTAAGAGACTGG - Intergenic
995871887 5:116752118-116752140 AAATCTATGCCCTTTGATTGGGG - Intergenic
996207738 5:120762617-120762639 AAAACAATGCCCTTAAAAAGTGG - Intergenic
1005828316 6:29650052-29650074 AAAGCTCTGCCCTTAGGAACGGG + Intergenic
1007025891 6:38573565-38573587 AAGGTTATGCCCGTTGAGAGAGG - Intronic
1007662319 6:43494500-43494522 ACAGCTATGCCCTGGGAGAAAGG - Intronic
1010484797 6:76397309-76397331 AAAGCTATCCCCTCAGACAGAGG + Intergenic
1010819133 6:80392835-80392857 AAAGGTTTGCCTTTGGAGAGTGG - Intergenic
1011704814 6:89990195-89990217 GGAGCTATACCCTTAGAGACAGG + Intronic
1012613324 6:101243860-101243882 AAAGGCATGTCCTTAGAGAAAGG - Intergenic
1018454025 6:163936084-163936106 TAGGCTATACCCTGAGAGAGCGG - Intergenic
1021402372 7:20223967-20223989 AAAACTATGCAGTTAGATAGTGG + Intergenic
1026896402 7:74012402-74012424 GAGGCTATGCCCTTGGAGACTGG + Intergenic
1032489831 7:132316101-132316123 ACTGCTATGCCCTTGAAGAGGGG + Intronic
1034784646 7:153914503-153914525 AAAGCTATTCCCTCAAAGATAGG - Intronic
1035814577 8:2525761-2525783 ATAAATATGCCCATAGAGAGAGG - Intergenic
1036305703 8:7600200-7600222 AAAGGTATGCCCTTCCAAAGTGG - Intergenic
1036356551 8:8048197-8048219 AAAGGTATGCCCTTCCAAAGTGG - Intergenic
1037800383 8:22031330-22031352 AGGGCTATACCCTTAGTGAGAGG - Intronic
1038105187 8:24425174-24425196 AAAGCTATGCCTTAAGAGAGAGG + Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039828398 8:41194109-41194131 AATGCTATGTTTTTAGAGAGGGG + Intergenic
1048117321 8:131539250-131539272 AAAGCTATACCTTTAGAAATAGG - Intergenic
1048945871 8:139446565-139446587 AAAGCAATTTCCTTAGAGAGTGG + Intergenic
1051260490 9:15259235-15259257 AAAGTTATGTTCTTAGGGAGAGG + Intronic
1054443275 9:65285489-65285511 AAAGAGAAGCCCTTATAGAGTGG - Intergenic
1054784568 9:69198602-69198624 AAAGCAATAAGCTTAGAGAGGGG - Intronic
1056524679 9:87432275-87432297 AAAGCAAGGGCCTTAGAGAAAGG + Intergenic
1057646494 9:96879688-96879710 AGAGCTATGGCCTTAAAAAGAGG + Intergenic
1203573085 Un_KI270744v1:150920-150942 AAATCTATGGCCTCTGAGAGTGG + Intergenic
1188391409 X:29624929-29624951 GAAGGTATGCCCTAAGACAGGGG + Intronic
1189393876 X:40602787-40602809 AGAGCTGTGCCCTCAGTGAGAGG + Intronic
1189856669 X:45230552-45230574 ACAGCTATAACCTTAGAGAGAGG - Intergenic
1193288457 X:79741995-79742017 AAAGCTGTGCCTCTAGAAAGTGG + Intergenic
1197329947 X:125141385-125141407 AAAACTATGCACTCACAGAGAGG + Intergenic
1197472391 X:126879385-126879407 AAGACTATGTCCTCAGAGAGTGG - Intergenic