ID: 961569041

View in Genome Browser
Species Human (GRCh38)
Location 3:127785185-127785207
Sequence GTGTGGGGAAGGAGGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3817
Summary {0: 1, 1: 0, 2: 27, 3: 413, 4: 3376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961569041_961569050 -8 Left 961569041 3:127785185-127785207 CCTTCCCCCCTCCTTCCCCACAC 0: 1
1: 0
2: 27
3: 413
4: 3376
Right 961569050 3:127785200-127785222 CCCCACACACCTGCTGCAGGTGG 0: 1
1: 0
2: 1
3: 48
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961569041 Original CRISPR GTGTGGGGAAGGAGGGGGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr