ID: 961569041 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:127785185-127785207 |
| Sequence | GTGTGGGGAAGGAGGGGGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3817 | |||
| Summary | {0: 1, 1: 0, 2: 27, 3: 413, 4: 3376} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961569041_961569050 | -8 | Left | 961569041 | 3:127785185-127785207 | CCTTCCCCCCTCCTTCCCCACAC | 0: 1 1: 0 2: 27 3: 413 4: 3376 |
||
| Right | 961569050 | 3:127785200-127785222 | CCCCACACACCTGCTGCAGGTGG | 0: 1 1: 0 2: 1 3: 48 4: 358 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961569041 | Original CRISPR | GTGTGGGGAAGGAGGGGGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||