ID: 961569188

View in Genome Browser
Species Human (GRCh38)
Location 3:127786004-127786026
Sequence CACACAGGTGTGCCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961569179_961569188 30 Left 961569179 3:127785951-127785973 CCTGAGTGTCTGAGTGGCTGGGA 0: 1
1: 0
2: 9
3: 139
4: 1096
Right 961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 172
961569183_961569188 2 Left 961569183 3:127785979-127786001 CCTGGTGCAGGAGTCCTGCTGGG 0: 1
1: 0
2: 2
3: 35
4: 265
Right 961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961569188 Original CRISPR CACACAGGTGTGCCTACTCC AGG Intronic
900576113 1:3383248-3383270 CACACAGCCGTGCCTGCCCCTGG - Intronic
901022463 1:6262086-6262108 GACACAGGGGTGCCTAGTCATGG - Intergenic
901197028 1:7445975-7445997 GACACAGCTGTGGCTGCTCCAGG + Intronic
901400746 1:9013787-9013809 CACCCTGGTGTCCCGACTCCAGG - Intronic
902325873 1:15700365-15700387 CACACAGGGGTAGCTACTTCTGG - Intronic
902756029 1:18549847-18549869 CACACACATGTGCCTTGTCCTGG - Intergenic
903938013 1:26910037-26910059 GACACAGGTCTGCCTACTTAGGG + Intronic
908750402 1:67417050-67417072 TACACACCTGTGCCAACTCCTGG - Intronic
909502821 1:76354224-76354246 CGCACAGTTGTGCCAGCTCCAGG + Intronic
912040408 1:105383253-105383275 CACAAAGGTGTGCCTAGGCATGG + Intergenic
912377985 1:109227943-109227965 CACTCAGGTGTGTCTGCTCCAGG + Intronic
912520781 1:110243332-110243354 CACACAGGTGTCACCACTTCTGG - Intronic
914977031 1:152375446-152375468 CACATAGGTGTTACTACTTCCGG - Intergenic
915153537 1:153855369-153855391 CAGACAGGTGTCCCCACGCCCGG + Intronic
918825428 1:189317126-189317148 CAGTCAGGTGTGCCTCCTGCTGG - Intergenic
919574874 1:199295213-199295235 CAAACAGGTGTGCCTTCAACTGG - Intergenic
922597217 1:226823327-226823349 CACACAGGTGTTCAAACACCAGG - Intergenic
923131322 1:231077211-231077233 CACACAGATGTGACTTCTCCAGG - Intergenic
924161262 1:241234636-241234658 CACCCTGGTCTGCCTACTTCTGG + Intronic
1067359081 10:45560442-45560464 CACACAGGACTGCTCACTCCGGG + Intronic
1067518056 10:46971634-46971656 CACACAGGTTCCCCAACTCCTGG + Intronic
1067644192 10:48080194-48080216 CACACAGGTTCCCCAACTCCTGG - Intergenic
1070765588 10:79054340-79054362 CACACACGTGTGCATACACGGGG - Intergenic
1071564098 10:86662681-86662703 AACACAGGTCTTCCAACTCCAGG + Intronic
1072969799 10:100007418-100007440 CATACAGGTGTTCCTCCTCCCGG + Intronic
1073008526 10:100342424-100342446 CACACAGGTATGCATACTGGCGG - Intergenic
1073694395 10:105849002-105849024 CACATAGGTGTGGCAAGTCCTGG - Intergenic
1073716558 10:106114737-106114759 CACAAAGCTGTGCCGATTCCCGG + Intergenic
1074524316 10:114251008-114251030 CACCCAGTTCTCCCTACTCCTGG + Intronic
1074899969 10:117807603-117807625 CACACAGATGTGGCTACCTCTGG + Intergenic
1075592458 10:123702811-123702833 CACAAAGGCGTGCCCACTCCTGG - Intergenic
1075653410 10:124145176-124145198 CACCCAGGTCTGCTGACTCCAGG + Intergenic
1076821857 10:132943441-132943463 CTCCCAGGTGGGCCTACCCCAGG - Intergenic
1077179400 11:1205519-1205541 CACACAGGCGTGGCTCCCCCAGG + Intergenic
1079310637 11:19362526-19362548 CAAACAGGTCTGTGTACTCCTGG - Intronic
1080830778 11:35891356-35891378 AACACAGGAGTGCTTCCTCCAGG + Intergenic
1083900612 11:65641545-65641567 CACCCAGGTCTGCGTGCTCCAGG - Exonic
1084466625 11:69327041-69327063 CACACAAGTGTGCCCACTGCAGG - Intronic
1084506022 11:69568774-69568796 CACACAGGTTTCCATACTCAGGG - Intergenic
1085045589 11:73351120-73351142 CCCACAGGTGAGCCAGCTCCTGG - Intronic
1085371390 11:76009752-76009774 AACACAGGTTTTCCAACTCCTGG - Intronic
1086966380 11:93032273-93032295 CACCCAGGTCTACCTTCTCCAGG - Intergenic
1087139907 11:94755222-94755244 CACAGAAGACTGCCTACTCCTGG + Intronic
1103224677 12:119276566-119276588 CAGCCACATGTGCCTACTCCAGG - Intergenic
1104276577 12:127333900-127333922 CACTCAGTTGGGCCTCCTCCAGG - Intergenic
1104611177 12:130229025-130229047 CACACAGGTATGCTGACTTCGGG - Intergenic
1104960553 12:132486690-132486712 CACACAGCTGAGCCCACCCCAGG - Intergenic
1107959517 13:45545745-45545767 GACACAGGTGTCCCTACACAGGG - Intronic
1109047013 13:57425712-57425734 CCCAAAGGTGTGCCTACGCATGG - Intergenic
1113115822 13:106873876-106873898 CCCACAGGGCTGCCTACTCCTGG + Intergenic
1114484354 14:23054266-23054288 CACACTGGTGGGCCGGCTCCGGG - Exonic
1116650449 14:47585085-47585107 CATACAGGAGTGTCTATTCCTGG + Intronic
1117378453 14:55136965-55136987 CACACACTTATGCCTGCTCCTGG - Intronic
1120530078 14:85621595-85621617 CTCACAGGTGTCCAAACTCCTGG + Exonic
1120763664 14:88308582-88308604 CACACAAGTGTGCCTGTGCCGGG - Intronic
1121999994 14:98639693-98639715 CACACAGCTCTGTCTGCTCCTGG + Intergenic
1124179949 15:27463696-27463718 TTCACAGCTGTGCCTTCTCCTGG + Intronic
1127835045 15:62783927-62783949 CACACACTGGTGCCCACTCCTGG + Intronic
1128944298 15:71810855-71810877 CCCACAGGTATGGCTTCTCCTGG + Exonic
1129536622 15:76318370-76318392 CACACAGGTGTGGCTCCTAAGGG - Intergenic
1130193118 15:81755124-81755146 TTCACAGTTGTGCCTACCCCTGG + Intergenic
1131177255 15:90217823-90217845 CCCACAGGTGAGCCCACACCTGG + Exonic
1132677818 16:1127859-1127881 CACGCACCTGTGCCTTCTCCAGG - Intergenic
1132799525 16:1744987-1745009 CAAACAGTTGTGGCTACTCATGG + Intronic
1137035098 16:35563437-35563459 CTAACAGGTGTGCTTAATCCTGG + Intergenic
1138333243 16:56231885-56231907 CACAGAGGTGCACCTTCTCCTGG - Intronic
1143473697 17:7191547-7191569 CAGCCAGGTGTGGCTACTCCAGG + Intronic
1144681328 17:17197436-17197458 CTCACAGATTTGCCTACTCTGGG - Intronic
1148700086 17:49581885-49581907 CACACAGTTCTGCCTGCACCAGG + Intronic
1150810205 17:68350298-68350320 AACACAGCTCTCCCTACTCCTGG + Intronic
1152460931 17:80441965-80441987 CAACCAGGTGTTCCTTCTCCTGG - Intergenic
1152506495 17:80752474-80752496 CACACTGCTCTGCCTGCTCCTGG - Intronic
1154002124 18:10490821-10490843 CACTCAGGTCTGCCACCTCCGGG + Intergenic
1156822126 18:41385689-41385711 AACACAGGGGTGCCTACTGCTGG - Intergenic
1157182325 18:45508814-45508836 CACACAAAAATGCCTACTCCAGG + Intronic
1162361951 19:10225915-10225937 CTCACAGTTGTCTCTACTCCTGG + Intronic
1164040690 19:21490198-21490220 CTCACAGGTGTGCCGAATCTTGG - Intronic
1164303055 19:23978897-23978919 CTCACAGGTGTGCTGAATCCTGG + Intergenic
1164846032 19:31433252-31433274 CACACAGGTGGGAATATTCCAGG + Intergenic
1166269339 19:41704348-41704370 GACACTGGTGTTCCCACTCCTGG - Intronic
1166819512 19:45568851-45568873 CACAGAGGGGTGCCTCATCCCGG - Intronic
1167607138 19:50487533-50487555 CACAAAGGTCTGTCCACTCCTGG + Exonic
925554911 2:5120465-5120487 CACTCAGGAGTGCCTGCCCCTGG - Intergenic
927143306 2:20144352-20144374 CACAGAGGTGTGCCAACTTTGGG + Intergenic
927650806 2:24912535-24912557 CACACATGCGTGCTCACTCCTGG - Intronic
930760749 2:55032816-55032838 CAAACTGGTGTCCCAACTCCTGG - Intronic
930934261 2:56928632-56928654 CACACAGGAGTACATACTCCAGG + Intergenic
935861965 2:107340830-107340852 CTTACTGGTGGGCCTACTCCTGG + Intergenic
938316628 2:130333827-130333849 CACACAGGTCTGCCAGCACCTGG + Intergenic
938381319 2:130837822-130837844 CACACAGGTCTGCCTCCCCCTGG - Intronic
940693967 2:156956026-156956048 CCCACAGGTGTGCCTAGTCATGG + Intergenic
942531544 2:176915452-176915474 CAGACAGGTGGGCTTTCTCCAGG - Intergenic
945948007 2:216013157-216013179 CACACAGGTGTCCACACTCTCGG + Intronic
946177224 2:217929189-217929211 CACCCAGATGGGCCTACCCCAGG + Intronic
946202147 2:218076642-218076664 CCCAAAGGTGTGCCCAGTCCAGG - Intronic
947586420 2:231359589-231359611 CACAAAGCTGTGCCCACGCCAGG - Intronic
948625397 2:239265194-239265216 CCCACATGTGTGCCAACCCCAGG + Intronic
948899403 2:240948620-240948642 CACACAGCAGTGCCCATTCCTGG - Intronic
1168905403 20:1399380-1399402 TACACAGGTGGGCCTACTAGAGG - Intergenic
1171487478 20:25494920-25494942 CACCCAGGTCTCCCTTCTCCTGG - Intronic
1172093294 20:32448359-32448381 CACACAGATGTTTCTTCTCCTGG - Intronic
1175759887 20:61555012-61555034 CACACAGGTGTGCACACACATGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178928838 21:36799324-36799346 CACACAGGTGAGTCTACTTCTGG + Intronic
1179463710 21:41556565-41556587 CACAGAGCTGTGCCTAAACCAGG + Intergenic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1183018224 22:35007251-35007273 CACAGAGGTGGGGCTACACCTGG - Intergenic
1183627900 22:39015831-39015853 CACACAGGAGAGCCCACGCCGGG - Intronic
1183986155 22:41571802-41571824 GGCACAGGTGAGCCTAGTCCAGG - Intronic
1184196635 22:42934253-42934275 CACACAGTTGAGCATACTCTGGG - Intronic
1184225580 22:43127428-43127450 CCCACAGGTGGGCCTGCCCCAGG + Intronic
1184645273 22:45891795-45891817 CACACAGGTGTGGCCGATCCCGG - Intergenic
1185102339 22:48848078-48848100 CCCACAGGTGTGCCTCCCACAGG - Intronic
950026467 3:9823638-9823660 GACATAGGTGTGAGTACTCCTGG + Intronic
953233376 3:41084673-41084695 AACACAGGTTTGCCAACACCCGG + Intergenic
953343962 3:42159899-42159921 TAAACAGGTGTGCCTGCTCAAGG + Intronic
953406827 3:42663935-42663957 CACACAGGTGCGGCTGCCCCTGG + Exonic
954678510 3:52328592-52328614 CACACAGGTTTGCCTTGTCTTGG + Intronic
954720540 3:52558320-52558342 CCCACAGGGGTGCCTGCTCGGGG + Intronic
956198028 3:66673312-66673334 CACACATGTGTGAGTATTCCTGG + Intergenic
956716587 3:72085332-72085354 CACCCAGGTGTGGCAGCTCCTGG - Intergenic
956717001 3:72087775-72087797 CACCCAGGTGTGGCAGCTCCTGG - Intergenic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
962419914 3:135218866-135218888 AACACAGGTGTTCCTTCTTCAGG - Intronic
962988574 3:140558179-140558201 CACACACGTGTGCCTTTTCTAGG - Intronic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
968641249 4:1716246-1716268 GACACAGGTGTGGCTACTGGAGG - Exonic
968679366 4:1905970-1905992 CACCCATGTGTGCCTGCACCCGG - Intronic
968806754 4:2778503-2778525 CACTCTGGTGTGCCAAGTCCTGG - Intergenic
968964401 4:3762339-3762361 CACACACCTGTGCATACTGCGGG - Intergenic
968970844 4:3792793-3792815 CACACATGTGTGCATACCACAGG - Intergenic
968980847 4:3848631-3848653 CAGCCAGGTGTGCCTACCCTGGG - Intergenic
978018332 4:103777289-103777311 CATAAACGGGTGCCTACTCCTGG + Intergenic
982332097 4:154192343-154192365 CAAAGAGGTTTGCCCACTCCCGG - Intergenic
982371511 4:154638690-154638712 CACACATGTGTGCCTGCACCAGG - Intronic
984458071 4:179996491-179996513 CACATAGTTGTGCTTGCTCCTGG - Intergenic
985969355 5:3362753-3362775 GGCACTGGTGTCCCTACTCCAGG - Intergenic
986525575 5:8670934-8670956 CACACAGCAGTCCCCACTCCAGG + Intergenic
991547785 5:67802688-67802710 CACACATATGTGCCTAAGCCAGG - Intergenic
994664715 5:102693273-102693295 CAGACAGGTATCCCTTCTCCAGG - Intergenic
996962580 5:129269383-129269405 CACAGAGCTGTGCTGACTCCAGG - Intergenic
999872499 5:155766913-155766935 CACACTGGAGTGGCTACTCGAGG - Intergenic
1000496101 5:161987357-161987379 TACACAAGTGTGCTTACTTCAGG - Intergenic
1001481328 5:172091130-172091152 CACAGAGCAGTGCCCACTCCCGG + Intronic
1002442752 5:179272895-179272917 GACACAGGTGAGGCTACTGCAGG - Exonic
1002716202 5:181229697-181229719 ATGACAGGTGTGCCTCCTCCAGG - Intronic
1002902024 6:1417351-1417373 TGCACAGGTGTTCCTTCTCCCGG + Intergenic
1003401395 6:5794065-5794087 CCCACAGTATTGCCTACTCCAGG - Intergenic
1006072577 6:31507990-31508012 CCCACCCGTGTGCCTCCTCCAGG + Intronic
1008776038 6:55039013-55039035 AACTCAGGTGTGCCTGCTCAAGG + Intergenic
1010062277 6:71636531-71636553 CACACAGCTGCTCCTGCTCCAGG + Intergenic
1011333327 6:86234152-86234174 GACACAGGTTTGTCTACTCTTGG + Intergenic
1013421877 6:109974541-109974563 CTCCCAGGTGTGCCCTCTCCTGG - Intergenic
1014526573 6:122508609-122508631 CAAACAGCTGTGCGTACTCAGGG - Intronic
1017223352 6:151991844-151991866 CAGACAGGAGTGCCTTCTCAGGG + Intronic
1018761696 6:166899222-166899244 CACACAGGTGGGCGAACGCCGGG + Intronic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1019631216 7:2050784-2050806 CGCACAGGTGTGTTTGCTCCTGG - Intronic
1022483677 7:30760974-30760996 CACACAGGTGTTCCCTCTGCTGG - Intronic
1023805264 7:43868947-43868969 CACACAGGTGAGCGGACCCCAGG - Exonic
1027164509 7:75824922-75824944 CAGACATGTGTGCCTGCACCTGG - Intergenic
1033015977 7:137672157-137672179 CACACAGGTGCGTCTACAGCAGG - Intronic
1034276302 7:149825332-149825354 CACACAGCTGTGCCGACCTCTGG + Intergenic
1035656212 8:1308054-1308076 CACAAAGCTGTGCATACACCAGG + Intergenic
1036577451 8:10041201-10041223 CACAAAGATGTGACTATTCCTGG + Intergenic
1037448981 8:18997689-18997711 CACACTGGTGTCCCTGTTCCTGG + Intronic
1040024410 8:42768748-42768770 CTCACAGGTGTTCATCCTCCCGG - Exonic
1041273455 8:56132283-56132305 AACACAGCAGTGCATACTCCTGG - Intergenic
1042089767 8:65145984-65146006 CACACAGGTGGTCCTGCTCCTGG - Intergenic
1044913764 8:97090160-97090182 CACCCAGGTCTCCCTACTCCAGG - Intronic
1046261518 8:111774220-111774242 CACACAGGTGTGCATGCTATTGG + Intergenic
1049537351 8:143188559-143188581 CACACAGGCGTGGCTGCTCCGGG + Intergenic
1049748197 8:144271857-144271879 CACACAGCTCGGCCTTCTCCCGG + Intronic
1051216036 9:14798814-14798836 CAGACAGGTGTGACCACACCTGG + Intronic
1052734194 9:32323373-32323395 CACACAGGAGTGCCCACTGCAGG + Intergenic
1053267106 9:36723507-36723529 GACCCAGGTCTGCCTGCTCCTGG + Intergenic
1057197302 9:93122167-93122189 CTCACAGGTATGGCGACTCCTGG + Exonic
1059465804 9:114468081-114468103 CACACAGCTGTGCCCTCCCCTGG - Intronic
1061204450 9:129154955-129154977 CTCACAGGTCCGTCTACTCCTGG - Intergenic
1061208729 9:129178592-129178614 CACTCAGGTGAGCCGACCCCCGG - Intergenic
1061496133 9:130975506-130975528 CACACACGGGGGCCTACTCAAGG + Intergenic
1185847092 X:3447815-3447837 CACACAGGTGTACACACTCAGGG - Intergenic
1186192794 X:7082679-7082701 CCCACAGGTGTGTCTGGTCCTGG - Intronic
1190383267 X:49860176-49860198 CACATAGTTTTGCCTTCTCCGGG + Intergenic
1190803687 X:53814813-53814835 CACACAGCTGTGCCGAGTCTGGG - Intergenic
1190983781 X:55482446-55482468 CACACAGTAGTGGCTACTCCAGG - Intergenic
1191232603 X:58107797-58107819 CACACAGGTGTGTCTATTTTTGG - Intergenic
1193052864 X:77119793-77119815 CACACAGGTTTATCTACTCAAGG + Intergenic
1194157187 X:90405139-90405161 CTCAGAGGTGTGCCTAAGCCTGG - Intergenic
1199347709 X:146761263-146761285 CATATAGGTGTGCCTCCTGCTGG - Intergenic
1200503519 Y:3982122-3982144 CTCAGAGGTGTGCCTAAGCCTGG - Intergenic