ID: 961569276

View in Genome Browser
Species Human (GRCh38)
Location 3:127786477-127786499
Sequence AGGGAGAAGGCAATGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961569270_961569276 -2 Left 961569270 3:127786456-127786478 CCAGTTGGGAGCCAGTCGTTCAG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG 0: 1
1: 0
2: 9
3: 52
4: 364
961569267_961569276 23 Left 961569267 3:127786431-127786453 CCTGGAACTTCTTTAACGGCTGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG 0: 1
1: 0
2: 9
3: 52
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961569276 Original CRISPR AGGGAGAAGGCAATGACTGT GGG Intronic
900120704 1:1047543-1047565 AGGGAGTAGGCAAGGACTTGGGG - Intronic
900707699 1:4090683-4090705 AGGGAGAAGGCAGTGTCAGGAGG + Intergenic
900964267 1:5946897-5946919 ATGGAGAGGGCAAAGAATGTGGG - Intronic
903925699 1:26829031-26829053 AGGGAGAAAGCAAGGACTTCTGG + Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907247427 1:53116943-53116965 AGGGAGAAGGAAAGGACACTGGG + Intronic
907720350 1:56966212-56966234 AGTGAGGTGGCAAGGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909172750 1:72316529-72316551 AGGGTGAAGGCCATTACGGTGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913063138 1:115226065-115226087 ATGGAGAAGGCACGCACTGTGGG + Intergenic
913116207 1:115699666-115699688 GGGGAGAAGGCAATGAGTTCAGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916547650 1:165821562-165821584 AGTGAGGAGGCACTGACTCTTGG - Intronic
917201492 1:172521121-172521143 AGGGATAATGCAAAGTCTGTGGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918576422 1:186066415-186066437 AGGGTAAAGGCACTGACTTTTGG - Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
920224057 1:204425110-204425132 AGGGAGATGGTAAAGTCTGTTGG + Intronic
920253438 1:204638077-204638099 TGAGAGCAGGCAATCACTGTTGG - Intronic
920743436 1:208602840-208602862 AGGTAGAAGGAACTGTCTGTTGG + Intergenic
920863426 1:209730947-209730969 TGGAAGAAGGAAATGACAGTAGG + Intronic
922729376 1:227941943-227941965 AGGGAGGAGGTGATGCCTGTGGG - Intronic
922998413 1:229985172-229985194 AGGGAGAAGGCAGAGTCCGTGGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064151620 10:12870426-12870448 TGGGAGAAGGGAAGGTCTGTTGG + Intergenic
1066358666 10:34709738-34709760 AGGGAGAAGGGAACTACTTTGGG + Intronic
1067229162 10:44395003-44395025 AGGAGGGAGGCAGTGACTGTTGG - Intergenic
1067487370 10:46663286-46663308 AGGTAGAAGGCAATTACTTTAGG - Intergenic
1067702039 10:48580696-48580718 GGCCAGAAGGAAATGACTGTGGG + Intronic
1068206657 10:53863857-53863879 AGAAAGAAGGCAAAGAATGTTGG + Intronic
1070401595 10:76057583-76057605 AGGGAGAAAGCAATGAAGGGTGG + Intronic
1071582706 10:86788046-86788068 AGGGAAAAGGGAAGTACTGTGGG + Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071622991 10:87140100-87140122 AGGTAGAAAGCAATTACTTTAGG + Intronic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1072537837 10:96376847-96376869 AGAGAGAAGTCATTCACTGTGGG + Intronic
1072725865 10:97813529-97813551 AAAGAGAAGGCAGTGACTTTAGG + Intergenic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073097885 10:100991115-100991137 AGGCAGGAGGCAATGCCTCTGGG + Intronic
1074758113 10:116642642-116642664 AGGGGCAAGGCAATGATTGTAGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076288901 10:129328774-129328796 GTGGAGAAGGAAATGACTTTGGG + Intergenic
1078200608 11:9179384-9179406 AGGGAGAAAGGAAGGAATGTGGG + Intronic
1078518364 11:12044390-12044412 TGGGGGAAGGGAATGGCTGTGGG + Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081520753 11:43878939-43878961 AGGGAGTAGTCAAACACTGTGGG + Intergenic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081633605 11:44705845-44705867 AGGGAGAAGGCAAGGAGTGGAGG - Intergenic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1082635719 11:55590996-55591018 ATGGAGAAGGCTATGTATGTGGG - Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1082961428 11:58922008-58922030 AGGAAAAAGGCAATCAATGTGGG - Intronic
1083292104 11:61696092-61696114 AGGGAGCAGGAAATGAGAGTGGG + Intronic
1084141526 11:67233974-67233996 AGGGAGAATTCAAACACTGTCGG - Intronic
1085324031 11:75593043-75593065 AGGGGGCTGGCCATGACTGTGGG - Intronic
1088449216 11:109964262-109964284 AGGGAGAGGGCCATTACAGTGGG + Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1090441993 11:126731993-126732015 AGGGTGAAGGAAATCACTGCAGG + Intronic
1090896011 11:130976329-130976351 CGGCAGAAGGGCATGACTGTTGG - Intergenic
1092664387 12:10779245-10779267 AGGGAGCAGGAGAGGACTGTGGG + Intergenic
1093089915 12:14909584-14909606 TGGGAGAAGCTAATGACTTTGGG - Intergenic
1094190127 12:27689673-27689695 AGGGAGAAGGCAAGGACTCAAGG - Intronic
1095372231 12:41482418-41482440 AGGAAGAGGGAAATAACTGTTGG + Intronic
1095494972 12:42774715-42774737 AGTAAGAAGGAAATGTCTGTTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096815118 12:54197004-54197026 AGGCAGAGGGCAATGACAGACGG + Intergenic
1097378130 12:58862005-58862027 AAGGAGAGGGGAATGACTGACGG - Intergenic
1098787112 12:74773572-74773594 AGTGTCAAGTCAATGACTGTTGG + Intergenic
1099097648 12:78395472-78395494 AAGGAGAAGGAAAGGACTGTTGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100077523 12:90803450-90803472 AGGGAGAAAGAAATGACCATTGG - Intergenic
1102236300 12:111296608-111296630 AGGGAGGAGGCAAGTACTGGAGG - Intronic
1102236432 12:111297080-111297102 AGGGAGGAGGCAAGTACTGGAGG - Intronic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104668915 12:130667181-130667203 AGGGAGGAGGCAAGGAGTGAGGG + Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107215529 13:37913995-37914017 TGGGCTAAGGAAATGACTGTAGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108185513 13:47884825-47884847 AGGTAGAAGGAAAGGACAGTGGG - Intergenic
1108264032 13:48686612-48686634 ACGGAGCAGCCCATGACTGTGGG - Intronic
1108915853 13:55610188-55610210 AGGGAGAAGTCAATGGCTTTAGG + Intergenic
1109579288 13:64304579-64304601 AAGGGAAAGGCAATGACTGTTGG - Intergenic
1110419433 13:75288639-75288661 AGGGAGGAGGAATTGAATGTAGG - Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111496426 13:89056383-89056405 AGGGAGAAGGAAAGGAGTGGGGG - Intergenic
1112672435 13:101655669-101655691 ATGGAGAAGCAAATGAATGTTGG - Intronic
1113337920 13:109394545-109394567 AGGGAGAAGGGAAAGTCTCTGGG - Intergenic
1113560284 13:111273303-111273325 TGGGAGTAGGCAATGGCTCTTGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115740110 14:36378654-36378676 AGTGAGAAGTCCATGACAGTTGG - Intergenic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1119346772 14:73931739-73931761 AGGAATGAAGCAATGACTGTGGG + Exonic
1119636564 14:76278112-76278134 AGAGGGAAGGAAATGATTGTAGG + Intergenic
1119849987 14:77860425-77860447 AGGGAGCTGGCACTGACTATTGG + Intronic
1120786986 14:88547127-88547149 AGAAGGAAGGCAATGCCTGTGGG + Intronic
1122151592 14:99728845-99728867 AGGCAGAGGGCATGGACTGTGGG - Intergenic
1126070829 15:44863584-44863606 AGGGAGGAGGTAATGATTTTTGG + Intergenic
1126154025 15:45548434-45548456 TGGGAGAAGCCTATGAGTGTAGG - Intergenic
1127191090 15:56531341-56531363 AGGGAAAAGAGAATTACTGTGGG + Intergenic
1128117337 15:65118157-65118179 AGGAAGATGGCAGTGGCTGTAGG - Exonic
1128187564 15:65656032-65656054 GAGGAGAAGGCAATGCTTGTGGG + Exonic
1128449059 15:67791261-67791283 AGGGATGAGGCAAAGACTGAAGG + Intronic
1128961759 15:72013689-72013711 ATGGAGTAGGCAATTAGTGTGGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130012413 15:80161876-80161898 AGGGAGAAGTCAATCAGTATAGG + Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1130699479 15:86164275-86164297 AGGGAGGAGGAAATGACACTGGG + Intronic
1131411722 15:92213124-92213146 AGGGAGGAGGTAATGATTTTTGG - Intergenic
1132327860 15:100986788-100986810 AGGCAGAGGGCAAGGAGTGTAGG - Intronic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1137545978 16:49403846-49403868 AGGGAGTAGTCCAAGACTGTGGG + Intergenic
1138057488 16:53850473-53850495 AGGGAGAAGGTCATGACTTATGG + Intronic
1138317908 16:56086216-56086238 AGGGAAAAGGCCATGAATGCTGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139032023 16:62895669-62895691 AGGGGAAAGGGAATGAGTGTGGG - Intergenic
1140849972 16:78925974-78925996 AGGGAGAAGGGAAGGGATGTGGG + Intronic
1141982872 16:87560884-87560906 GGGGATGAGGCCATGACTGTGGG + Intergenic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143186787 17:5014829-5014851 ATGGAGAAGGTAATGGCTGAGGG + Exonic
1143446044 17:7010142-7010164 CGGGAGAGGGAAATGACAGTTGG + Intronic
1144029399 17:11305902-11305924 AGGGAGAAGGCATTATTTGTGGG + Intronic
1144096136 17:11902361-11902383 AGGGAGAAGTCACTAACTTTAGG + Intronic
1144362427 17:14507964-14507986 AGGGAGAAGGTGTTAACTGTGGG + Intergenic
1145095364 17:20020782-20020804 AGGGAGAAGAGAATGAGAGTGGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146596983 17:34177861-34177883 GTGGAAAAGGAAATGACTGTAGG - Intergenic
1146665332 17:34698640-34698662 ACGGAGATGGGAAAGACTGTGGG + Intergenic
1147300707 17:39524577-39524599 AATGGGAAGGCAAAGACTGTGGG - Intronic
1147661233 17:42118146-42118168 AGAGAGAAGGCAGGGACTGGGGG + Intronic
1148885499 17:50769240-50769262 AGGAAGAAGGCAAAGTGTGTTGG + Intergenic
1149649296 17:58266930-58266952 AGAGAGAAACCAATGACTGTTGG + Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1151441315 17:74131047-74131069 AGGGAGAAGGCATTGATGGCAGG - Intergenic
1151834354 17:76573348-76573370 AGGGTGGAGGCGATGACTGTGGG + Exonic
1153279132 18:3397817-3397839 AGTGAGAAGGGAATAATTGTGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156039106 18:32799731-32799753 AAGTATAAGACAATGACTGTTGG + Intergenic
1157498495 18:48172839-48172861 AGGGAGGAGACACAGACTGTCGG + Intronic
1157763816 18:50283074-50283096 AGGGAGAAGGAAAAGAATGGAGG + Intronic
1158268696 18:55688633-55688655 AAGGAGAAGGCCATGACTTAGGG - Intergenic
1159403192 18:67963838-67963860 AGGGAAAAGAGAAAGACTGTTGG - Intergenic
1162007712 19:7790506-7790528 AGGGGGAACGCAATGAATTTTGG + Intergenic
1162294909 19:9806721-9806743 TGGGAGAAGGCAATGATTAGGGG + Intergenic
1162624201 19:11871151-11871173 AGGGAGGAGTCATTGATTGTCGG + Intronic
1163041821 19:14608376-14608398 AGGGAAATGGGAATGACTGGGGG - Intronic
1164112074 19:22174926-22174948 TGGGAGAAGCCAATGACTTTAGG + Intergenic
1164196560 19:22970655-22970677 TGGGAGAAGCCAATAACTTTAGG + Intergenic
1165047616 19:33118072-33118094 AAGGAGAAGACAATGACTCTAGG + Intronic
1165953092 19:39485701-39485723 TGGGAGAAGGCAAGGGCTGGTGG - Exonic
1166413476 19:42573777-42573799 AGGAAGAAGGGAATGACAATGGG + Intergenic
1166449511 19:42886221-42886243 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166460809 19:42986514-42986536 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166478104 19:43146504-43146526 AGGGAGAAGGGAATGCATGGTGG - Intronic
926149305 2:10415792-10415814 AGGGGAAAGGCATTGAGTGTGGG - Intronic
927855999 2:26528300-26528322 AGGGAGACAGCAAGGAATGTGGG + Intronic
930606188 2:53495908-53495930 AAGGATAATGCAATGAGTGTTGG - Intergenic
930773579 2:55151379-55151401 ATGGAGAAGGAACTTACTGTGGG - Intergenic
931461864 2:62456939-62456961 TGGGAGAAGGCAAGGACGGGAGG - Intergenic
933783573 2:85819569-85819591 AGCAAGAACCCAATGACTGTTGG + Intergenic
933917922 2:87015081-87015103 AGGAACATGGGAATGACTGTAGG - Intronic
934005073 2:87754833-87754855 AGGAACATGGGAATGACTGTAGG + Intronic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935768034 2:106388873-106388895 AGGAACATGGGAATGACTGTAGG + Intergenic
936499866 2:113058707-113058729 AGGGAGAAGGGAAGGAGTGAAGG + Intronic
937315737 2:120930996-120931018 AGGGACAAGGCCATTTCTGTGGG - Intronic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
937438603 2:121898552-121898574 AGGCAGAAGACACTTACTGTTGG + Intergenic
937667009 2:124499361-124499383 ATGGAGAAGGCAGCCACTGTGGG + Intronic
938640186 2:133269592-133269614 AGGGAGAGGTCAATGAGGGTAGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939501851 2:142996625-142996647 AGGGAACAGGCAGTAACTGTGGG + Intronic
939852386 2:147317485-147317507 AGGGAGGAGGCAATGATTTTTGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940892342 2:159047193-159047215 AGGAAGCAGGCAATAACTGGGGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941868719 2:170361410-170361432 AGGGAGAAGGTGATGACTTGGGG + Intronic
941907796 2:170733878-170733900 AGGGAGAAAGCCCTGACTTTGGG - Intergenic
941950057 2:171145904-171145926 ATGGAGAAGGTAGTGACTGATGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944547619 2:200812623-200812645 GGGGAGGAGGCTAGGACTGTGGG + Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944981725 2:205128328-205128350 AGGAAGAAGGTATTAACTGTGGG - Intronic
946890249 2:224268445-224268467 AGGCAGTAGGCAATGAAGGTTGG - Intergenic
946905801 2:224414870-224414892 AGGTAGAAGGAAATCACAGTAGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1172092311 20:32442083-32442105 ATGGAGAAGGGCATGACTTTGGG - Intergenic
1172188922 20:33049895-33049917 AGGGAGAAGGCAAGGTAAGTGGG - Intergenic
1172980390 20:38937269-38937291 TGGGAGAGTGCCATGACTGTGGG + Intronic
1173479451 20:43387783-43387805 TGGGAGTAGGCAATGACAGATGG - Intergenic
1173496936 20:43526255-43526277 AGGGAGGAAGAAATGGCTGTTGG + Intronic
1173743459 20:45418991-45419013 AGGAAGAAGGAAAGGGCTGTAGG - Intronic
1174212304 20:48889787-48889809 AAGAAGAAGGCAATGACTGTTGG - Intergenic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1174531621 20:51219112-51219134 AGGGAGACAGAAATGACTGCTGG + Intergenic
1174847304 20:53955114-53955136 ATGGAGAAGGCATCAACTGTAGG + Intronic
1175167348 20:57054288-57054310 TGGGAGAAGGCGCTGGCTGTGGG - Intergenic
1175454009 20:59096092-59096114 GGAGAGCAGGCAGTGACTGTGGG - Intergenic
1175619322 20:60430311-60430333 AGGAAGAAGGCAAGGGCTCTAGG - Intergenic
1175687641 20:61043347-61043369 AGGAAGAAGCCAATTACAGTTGG + Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177135807 21:17304451-17304473 AGGGAGAAGGTGATGATTTTTGG - Intergenic
1177919654 21:27135443-27135465 AGAGAGAAAGTAATGCCTGTAGG + Intergenic
1178592688 21:33924678-33924700 GGGAAGACGGTAATGACTGTAGG + Intergenic
1178841104 21:36138074-36138096 AGTGAGAAGCCAAACACTGTGGG - Intronic
1179280538 21:39930366-39930388 ATGGGCAAGGCAATGACTGCAGG + Intergenic
1181521106 22:23449269-23449291 AGGGAGAAGGGGCTGAGTGTGGG - Intergenic
1182357991 22:29730829-29730851 AGGGAGAAGGGAGTGAGCGTGGG + Exonic
1183577019 22:38698072-38698094 AGGGAGAAGGAAAGGACTCAGGG - Intronic
1184116101 22:42423264-42423286 TGGGAGAAAGGAAAGACTGTGGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951369989 3:21834180-21834202 AAGGAGAAGGGAATGAATGGAGG - Intronic
952222890 3:31342301-31342323 AGGAGGCAGGCAAAGACTGTAGG + Intergenic
953532595 3:43752098-43752120 AGGGGGAAGGCCAAGAATGTGGG + Intergenic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954511665 3:51131074-51131096 AGGGAGAGGGCTATTACGGTGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
956948951 3:74257842-74257864 AGGGAGAAAACAATGGATGTGGG - Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957630229 3:82708461-82708483 AGAGAAAAGGCAATGACTAGAGG - Intergenic
958019446 3:87979142-87979164 AGGGAGATGGGAAAGACTGAGGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959971826 3:112417938-112417960 AGGGAAAAGGCAAGGACTTAAGG + Intergenic
960265978 3:115621582-115621604 AGGGAGGAGGCAGAGAATGTGGG - Intergenic
960944135 3:122954444-122954466 ACTGAGGAGGCAATGCCTGTTGG - Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963335220 3:143967476-143967498 AGGGACAAGGGAATCACTCTGGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964094326 3:152914071-152914093 AGGAAAAAGACAATGACTTTGGG - Intergenic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
968936305 4:3612253-3612275 CAGGAGGAGGCAGTGACTGTGGG + Intergenic
970275572 4:14396419-14396441 AGAGAAATGGAAATGACTGTAGG + Intergenic
972061498 4:34879313-34879335 AGGGAGAAGGGGATGATTTTAGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
975095753 4:70454453-70454475 AGGGAGCATGCAGTGCCTGTGGG - Intronic
975110089 4:70613674-70613696 ACAGAGAAGGAAATGACCGTGGG + Intergenic
975618930 4:76276322-76276344 AGAAAGAAGGCAAAGACTGTTGG + Intronic
977583325 4:98748004-98748026 AGGAAGTAGGGAAGGACTGTGGG + Intergenic
978879076 4:113678774-113678796 TGGGTGAAGGAAATGCCTGTGGG - Intronic
979897109 4:126172502-126172524 TGGAAGACGGCAATGCCTGTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981078687 4:140616939-140616961 AGGGAGACGGCAACCACTGAAGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981172967 4:141646109-141646131 GGGGGGAAGGCACTGACTGATGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987311133 5:16682080-16682102 AGGAAGAAGGCACTGAGTCTCGG - Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988403737 5:30796854-30796876 AGAGAGATGGAAATAACTGTAGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
988955282 5:36310293-36310315 AGGAAGTAGGAAATGGCTGTTGG - Intergenic
990962204 5:61406095-61406117 ATGGAGAAGGCCAAGACTGGAGG - Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991450307 5:66744043-66744065 AAAGAGAAGGAAATGACTGAGGG - Intronic
992142447 5:73812673-73812695 AGGGAGACGGCAAGAACTGTTGG + Intronic
992580300 5:78168065-78168087 AATTAGAAGGCAAAGACTGTAGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994162011 5:96567465-96567487 AGTGAGAAGGCAATTCCTGCTGG - Intronic
994287118 5:97982601-97982623 AGGGAGAGGCCATTGAATGTTGG - Intergenic
994606989 5:101980167-101980189 AGGTAGAAGGGGATGGCTGTTGG - Intergenic
995753348 5:115476110-115476132 AAGGGGAAGGGAAAGACTGTGGG - Intergenic
997241331 5:132310384-132310406 AGGGAGATGGCCATGAATGCAGG + Intronic
997511068 5:134454726-134454748 AGGGAGAAGGAAATAAGCGTTGG + Intergenic
997517813 5:134503361-134503383 AAGGACAAGGCAATGCCTGGAGG - Intergenic
997822519 5:137078778-137078800 AGGAAGAAGAGAATGAATGTGGG - Intronic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
999213172 5:149907964-149907986 AGGGAGAAGGTTATGATTGCGGG - Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999353207 5:150897591-150897613 AGGGTGAAGGCAAGCAGTGTTGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999933480 5:156459143-156459165 AGGGAGAAGACAAAGACAGGAGG - Intronic
1000027582 5:157373300-157373322 AGGTAGAAGCCAAGGACAGTGGG - Intronic
1000063371 5:157675247-157675269 AGGGAGAATGAAATGAATATGGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1004537814 6:16519799-16519821 AGAGACAAGGCAATGCCTGTAGG - Intronic
1005162562 6:22881167-22881189 AGAGAGAATGCCAGGACTGTAGG + Intergenic
1006165423 6:32061789-32061811 AGGGAGAAGGCTATGACTAGGGG + Intronic
1006805422 6:36785495-36785517 AGGGAGTAAGCAATGGCTTTTGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008172739 6:48229729-48229751 AGGCACAAGGGTATGACTGTAGG - Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010543466 6:77121635-77121657 AGGGAGAAGTCAATGACAAGAGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1012953496 6:105543494-105543516 AGGGAGGAGGCACTGCCTTTTGG + Intergenic
1014785562 6:125614621-125614643 ATGGAGAGGGAAATGACTGTAGG - Intergenic
1015344927 6:132145095-132145117 AGAGAGAAGGAAAAGACTGAAGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016576388 6:145573681-145573703 AGGGTGAAGGCTATTACGGTGGG - Intronic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1018128878 6:160709053-160709075 AGGAACATGGGAATGACTGTAGG + Intronic
1018648310 6:165968829-165968851 AGGCAGAAGGCAGAGCCTGTAGG + Intronic
1020440231 7:8209799-8209821 AGGGAGAAGGGAATTTCTGGTGG + Intronic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021295525 7:18901524-18901546 TGGGAGAATCCAATGCCTGTAGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1023136982 7:37062589-37062611 AGGGAAAAGGAAATGAAAGTGGG + Intronic
1024377092 7:48652381-48652403 AGAGAGAAGGCACTGCCTATGGG + Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1025871203 7:65435816-65435838 AGTGTTAAGGCAATGACAGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030158247 7:106479498-106479520 AGGGAGAAGACAAAGAGTTTTGG - Intergenic
1030337988 7:108346129-108346151 GGCGAGGAGACAATGACTGTGGG + Intronic
1030716777 7:112816733-112816755 AGGGAGAAGGAAATTAATATTGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1033496763 7:141906401-141906423 AGGAACAAAGCAATCACTGTGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034946863 7:155267816-155267838 AGGGAGAAGACCATCATTGTGGG - Intergenic
1036571027 8:9979984-9980006 AGGGAGGAGGCAGTGGCTGGAGG + Intergenic
1037456247 8:19067406-19067428 CTGGAGAATGCAATGACTCTTGG - Intronic
1037500682 8:19482831-19482853 AGGGAGAGGGCCAAGACAGTTGG - Intronic
1037924657 8:22834741-22834763 AGGAAGAAGGAAATGAGTGAGGG - Intronic
1039378926 8:37066878-37066900 AGGCAGAAATCAATGAATGTAGG + Intergenic
1040796126 8:51291648-51291670 AGGGAGAAGGTGATGATTTTTGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044004811 8:86927402-86927424 AGGGAGAAGGTGATGATTTTTGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045322387 8:101091848-101091870 GGGGAGAAGGCAGTAACTGATGG - Intergenic
1047222776 8:122931825-122931847 TGGGAGAAGGAAATGAGTGGGGG + Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048198455 8:132351809-132351831 AGGGATAAGACAATCACTTTGGG + Intronic
1048412034 8:134185098-134185120 AGGTAGAAGGAGATGACTGTGGG + Intergenic
1048477836 8:134759015-134759037 AGGGAGAAGGGACTGACTATTGG + Intergenic
1049361448 8:142214146-142214168 AGGGAGCAGGCGATGACGCTGGG + Intronic
1050064066 9:1740249-1740271 ATGGAGAAGACAAAGACTTTGGG - Intergenic
1050694029 9:8259636-8259658 AGGGAGAAAGCAATGATTTGTGG + Intergenic
1051088712 9:13381285-13381307 AGGGAGCAGGAAATAGCTGTTGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052276610 9:26683586-26683608 AGGCAAAAGGCACTGACTGCAGG + Intergenic
1052477440 9:28978268-28978290 AGGGAGAAGAAAATTAATGTGGG - Intergenic
1053412969 9:37927735-37927757 AGTGGGAAGGCAATGACACTTGG + Intronic
1053484753 9:38443278-38443300 AGGGAGGAGGGAATGACTTTGGG + Intergenic
1055729517 9:79266023-79266045 AGAGATAAGGCAATTAGTGTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056891813 9:90501464-90501486 AAGGAGAAGCCACTGTCTGTTGG + Intergenic
1056905990 9:90648239-90648261 AGGGAGCAGGATATGACTATTGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058728143 9:107823403-107823425 AGGAAGAAGGAAATGGCAGTAGG + Intergenic
1058935420 9:109765412-109765434 ATGAAGACGGCAATGACTGCAGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060169107 9:121446192-121446214 AGAGAGGAGCCAATCACTGTGGG - Intergenic
1060452678 9:123757677-123757699 AGGGAGAAGGCTTGGGCTGTTGG - Intronic
1060572110 9:124651567-124651589 AGGGAGAAGGGAACCACTGTGGG - Intronic
1061669027 9:132178198-132178220 AGGGAGAAGAAAATGAGGGTGGG - Intronic
1062051690 9:134450581-134450603 ATGGGGAAGGCAGTGAGTGTGGG + Intergenic
1062168394 9:135120462-135120484 AGAGGCGAGGCAATGACTGTTGG + Exonic
1062675746 9:137742679-137742701 AGGGAGAAGCAAATGTCTGGGGG - Intronic
1186131073 X:6465790-6465812 AGGGAAATGGAAATGACAGTGGG + Intergenic
1186188185 X:7042085-7042107 AGGGAGAAGGGAATGCATGGTGG - Intergenic
1187120054 X:16396734-16396756 AGGGACAAGGAAATTATTGTTGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187713419 X:22076990-22077012 AGGAAGAAGCCAGTGCCTGTGGG + Intronic
1188013638 X:25084173-25084195 CAGGAGAAAGCAATGACTGCAGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188840762 X:35014174-35014196 AGTGAGAAGACACTGTCTGTGGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1189004199 X:36978955-36978977 AGGAAGAAGGAAATGGCTATTGG - Intergenic
1189044726 X:37578338-37578360 AGGGAGAAGGAAATGGTTGCTGG + Intronic
1189303005 X:39966428-39966450 AGAGAGAAGCCAATGTGTGTTGG + Intergenic
1189462004 X:41250573-41250595 ATGGACAAGGCAAAGACAGTAGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190266551 X:48830671-48830693 AGGGAGAGGGCACTGAGGGTCGG - Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193092918 X:77513440-77513462 AGAGAGAAGGCAATGAGAGTGGG + Intronic
1194078331 X:89425966-89425988 AGGAAGAAGGCATTGAGAGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194921475 X:99771447-99771469 AGGGAGAAGGGAGTGAAGGTAGG + Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195725772 X:107914580-107914602 AGAGAAAAGGCATTGAATGTAGG - Intronic
1195774133 X:108384375-108384397 AGGGGCAAGGCAATGAATGTAGG + Intronic
1196319750 X:114272467-114272489 AAGGCAAAGGAAATGACTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196489444 X:116249327-116249349 AGGGAGGAGGCAATGATTTTTGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197384643 X:125787991-125788013 AGGGTGAAGGGAAAGACAGTGGG + Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1197849649 X:130844060-130844082 AGGCTGAAGGCAAAGATTGTGGG - Intronic
1198047885 X:132920771-132920793 ATGGAGGAGACAATAACTGTAGG + Intronic
1198134810 X:133738313-133738335 AGGGAGAAAGCAATGACAGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199653878 X:149975470-149975492 AGGGAGGAGCCAAAGAGTGTTGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200430974 Y:3081498-3081520 AGGAAGAAGGCATTGAGAGTGGG + Intergenic
1201179404 Y:11331812-11331834 ATGAAGAAGGCAGTGCCTGTGGG - Intergenic