ID: 961569505

View in Genome Browser
Species Human (GRCh38)
Location 3:127787664-127787686
Sequence CCTCCAGCGAGGACACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961569505_961569515 20 Left 961569505 3:127787664-127787686 CCTGAGGGTGTCCTCGCTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 141
Right 961569515 3:127787707-127787729 CTCCAGGCAGTGCCTGCTCTTGG 0: 1
1: 0
2: 4
3: 35
4: 353
961569505_961569512 4 Left 961569505 3:127787664-127787686 CCTGAGGGTGTCCTCGCTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 141
Right 961569512 3:127787691-127787713 GGAGCATCGCCTGCCGCTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961569505 Original CRISPR CCTCCAGCGAGGACACCCTC AGG (reversed) Intronic
900507985 1:3039183-3039205 CCTGCAGCCAGGACCCCCTGCGG + Intergenic
901039205 1:6354160-6354182 CCTCCAGAGGGGACACCGGCCGG - Intronic
901199579 1:7459012-7459034 CCTTCAGCGAGGACAGTCTTGGG + Intronic
902290055 1:15429515-15429537 CCCCCAGCCAGAACACCCTGAGG + Exonic
902380892 1:16051757-16051779 CCTCCAGCCACGATGCCCTCAGG - Exonic
902458113 1:16550768-16550790 CCTCCAGCTGGGATACTCTCTGG + Intergenic
902475416 1:16681783-16681805 CCTCCAGCTGGGATACTCTCTGG + Intergenic
902494045 1:16857151-16857173 CCTCCAGCTGGGATACTCTCTGG - Intronic
902579052 1:17396915-17396937 TCTCCAGGGATCACACCCTCAGG - Intronic
903137406 1:21318450-21318472 TCTCCAGGGAGGACACCCCTAGG - Intronic
903151295 1:21411528-21411550 CCTCCAGCTGGGATACTCTCTGG + Intergenic
903421118 1:23218185-23218207 CATCCAGCTTGGACACCATCCGG - Intergenic
912510792 1:110188922-110188944 CCTCCTGCGTGGACTCCCTCAGG + Intronic
913611904 1:120516891-120516913 CCTCCAGCTGGGATACTCTCTGG + Intergenic
914579287 1:149005348-149005370 CCTCCAGCTGGGATACTCTCTGG - Exonic
915594175 1:156887109-156887131 CCTCCAGGGAGGTCCCCCTATGG + Intergenic
916577308 1:166079323-166079345 CCTCCTTCGAGAACACTCTCTGG + Intronic
920691352 1:208148812-208148834 CCTCCAGGAAGTACCCCCTCAGG - Intronic
922239878 1:223748640-223748662 GCGCCATCGAGGACCCCCTCCGG + Intronic
922620071 1:226983701-226983723 TCTGCAGGGAGGACCCCCTCTGG - Intronic
1063935274 10:11071233-11071255 CCTCCAGCTAGGACATGCGCTGG + Intronic
1064087402 10:12355666-12355688 ACTGCAGCGGGGATACCCTCGGG - Intronic
1064230765 10:13528396-13528418 CCCCCAGCGTGGACCCCCGCGGG + Intronic
1071554724 10:86593255-86593277 CCTCCAGCTAGGACAATGTCAGG + Intergenic
1071992748 10:91115851-91115873 CCTCCAGGCAGGACGCCCTGCGG - Intergenic
1074887421 10:117705108-117705130 CCTCCATCCAGGACACACTGGGG + Intergenic
1075006724 10:118835923-118835945 CCTCCAGCCAGGACAGCACCTGG + Intergenic
1077096116 11:799840-799862 CCTCCCGGTAGGACACCCCCAGG + Exonic
1077174980 11:1185031-1185053 TCTCCAGCCAGCACAACCTCTGG + Intronic
1078011593 11:7576696-7576718 CCACCAGCCAGGGCACCCTGGGG - Intronic
1080416953 11:32077789-32077811 CCTCTATCCAGGCCACCCTCTGG + Intronic
1081613636 11:44578112-44578134 CCTCCTGGGAGGCCGCCCTCAGG - Intronic
1083478860 11:62930660-62930682 TCCCCAGCTAGGACACCCTGTGG - Intergenic
1089100960 11:115962008-115962030 CCTCCCTGGAGGACACTCTCAGG - Intergenic
1090171681 11:124611329-124611351 CCTCCAGCAAGGACCCGCTAAGG + Intergenic
1092925692 12:13270037-13270059 CCTAGAGAGAGGACAGCCTCAGG + Intergenic
1095380859 12:41589957-41589979 CCTCCAGCCAGCACATGCTCTGG + Intergenic
1096693775 12:53336170-53336192 CCTCCAGAGAGGAGAGACTCGGG - Exonic
1097563845 12:61242082-61242104 CCTCCAGCCTGCACACCCCCAGG - Intergenic
1098604947 12:72379120-72379142 TCTCCAGGGAGGAGACCCTGTGG - Intronic
1100754308 12:97733359-97733381 CCTCCGGCGCGGACCTCCTCGGG + Intergenic
1104289619 12:127455764-127455786 CCTCCAGCGATGCCAACCGCCGG - Intergenic
1106566184 13:30886619-30886641 TCTCCAGGGAGGACACCTTCTGG + Intergenic
1106756426 13:32826987-32827009 CCTCCAGAGAGGCCAACATCTGG - Intergenic
1122204326 14:100141142-100141164 TCTCCAGCCAGGGCACCCACAGG + Intronic
1123919827 15:25062491-25062513 CCACCACCGAGGACATCCACAGG + Intergenic
1132602276 16:778662-778684 CCTGCAGCAAGGCCAGCCTCTGG + Exonic
1132730395 16:1358144-1358166 CCTCCAGCCAGGCCAGCCCCAGG - Intronic
1132953933 16:2581086-2581108 CCTGCCGCGTGCACACCCTCTGG + Intronic
1132960412 16:2619077-2619099 CCTGCCGCGTGCACACCCTCTGG - Intergenic
1132976911 16:2715602-2715624 CCCCCAGGGAGGTCACCCGCAGG + Intronic
1134553603 16:15149844-15149866 CTGCCAGCCAGGACAACCTCTGG + Intergenic
1136604686 16:31325383-31325405 CCTGGAGCGTGGACACCTTCCGG - Exonic
1137589868 16:49686976-49686998 CCTCCAGGCAGGAGACCCTGGGG - Intronic
1138512212 16:57515282-57515304 CTTCCAGCCAGGGAACCCTCCGG - Intronic
1139696432 16:68678570-68678592 TCTACAGCGAAGACACCCTCAGG - Exonic
1139721919 16:68863040-68863062 CCTCCAGGGAGGACCACCCCAGG + Exonic
1140985848 16:80157347-80157369 CCTCCTGAGAGGACCCTCTCTGG - Intergenic
1143055865 17:4161315-4161337 CCTACCGCAAGGACAGCCTCTGG - Intronic
1143106057 17:4531135-4531157 CTTCCCATGAGGACACCCTCCGG + Intronic
1143316528 17:6037353-6037375 CCCCCGGTGAGGACCCCCTCTGG + Intronic
1150648920 17:66997339-66997361 CCTCCAGTGAGGACCCCCAGAGG + Intronic
1151112214 17:71691474-71691496 CCTCCAGACAGAACACGCTCAGG + Intergenic
1151556769 17:74850653-74850675 CTTCCAGCGTGGCCACCGTCAGG + Exonic
1152216225 17:79034204-79034226 CCAGCAGCGGGGACGCCCTCGGG - Intronic
1152893376 17:82895617-82895639 CCTCCAGCGGGCACACCTCCAGG - Intronic
1157501203 18:48191922-48191944 ACTCCAGCAATCACACCCTCAGG + Intronic
1157978425 18:52352655-52352677 CCTCCACAGAGAAGACCCTCAGG - Intronic
1160426779 18:78783285-78783307 TCTCCAGCCAGCCCACCCTCCGG - Intergenic
1160907076 19:1456498-1456520 CCTCCATCCAGCACCCCCTCGGG + Intronic
1161041989 19:2115202-2115224 CCTCCAGCGAGGCTGACCTCAGG + Exonic
1161152628 19:2717672-2717694 CCACCATCGAGGACACCTACCGG - Exonic
1161265365 19:3361127-3361149 CCTCCAGCCAGGACCCCCTCGGG - Intronic
1163698867 19:18777345-18777367 CAGCCACCGAGGACACCTTCCGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1167253567 19:48414465-48414487 CCTCCAGCGTGGCCACCGTGAGG - Exonic
1167613030 19:50516536-50516558 CCACCAGCCAGGACAGCCTGGGG + Intergenic
1202709656 1_KI270714v1_random:10837-10859 CCTCCAGCTGGGATACTCTCTGG + Intergenic
925180036 2:1811576-1811598 CCACGAGCCAGGACCCCCTCAGG - Intronic
925607400 2:5673215-5673237 CCTGCAGCGTTGACACCATCTGG - Intergenic
926089571 2:10041765-10041787 CCTCTAGCGGACACACCCTCGGG - Intergenic
926132512 2:10313231-10313253 CCTCCAGGGAGGACAAATTCTGG + Intronic
926275583 2:11400764-11400786 CCTCCAGCTAGAACAGCATCAGG - Intergenic
926826860 2:16914375-16914397 CCTCCACTGAGGTCACCCGCTGG - Intergenic
932448469 2:71794870-71794892 CCTTCAGAGGGGACCCCCTCCGG + Intergenic
937910559 2:127073609-127073631 CCTCCTACGTGGACCCCCTCTGG + Intronic
938740660 2:134228681-134228703 TCACCAGAGAGGACACACTCTGG - Intronic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
1168876633 20:1176448-1176470 CTTCAAGCCAGGACATCCTCTGG - Intronic
1172745449 20:37204261-37204283 CATCCAGTGAGAACACCATCAGG - Intronic
1172894516 20:38291209-38291231 ACTCCAGCGGGGACACACTGTGG - Intronic
1172902109 20:38342929-38342951 CCTCCTGCCATGCCACCCTCTGG + Intergenic
1173744732 20:45427479-45427501 CCTCCAGGAAGCACACCATCTGG - Intergenic
1175963944 20:62650849-62650871 CGTTCAGCAAGGACTCCCTCAGG + Intronic
1178037696 21:28603085-28603107 CCTCCAGTGGGGACACACTGAGG + Intergenic
1179558028 21:42193172-42193194 CCTCCTGCGGGGACCTCCTCTGG - Intergenic
1179587922 21:42385494-42385516 CCTCCAGCGAGCTCACTCTGAGG + Exonic
1179906419 21:44425480-44425502 CCCCCAGGGAGGACAGCCACGGG - Intronic
1180875059 22:19171352-19171374 CCTCCAGCGTGGGCCCCCGCTGG + Intergenic
1182353439 22:29711341-29711363 CCTTCAGCCAGGTCACCCTGTGG - Intergenic
1182558928 22:31143785-31143807 CCTCCAGCCAGAGCACCATCAGG - Intergenic
1183577537 22:38701241-38701263 CGTCCAGGTAGGACTCCCTCAGG - Intronic
1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG + Intergenic
950490132 3:13299600-13299622 CCACACGGGAGGACACCCTCTGG - Intergenic
956770592 3:72522728-72522750 CCTCCAGCTTGGAAACCCTTGGG + Intergenic
956783743 3:72625075-72625097 CCTTCAACGAGGACAGCATCAGG + Intergenic
961569505 3:127787664-127787686 CCTCCAGCGAGGACACCCTCAGG - Intronic
965823591 3:172709111-172709133 CCTCCACAGAGTATACCCTCAGG - Intronic
968449075 4:666708-666730 ACTCCAGTGAGGACACCGCCGGG - Intronic
969603229 4:8189260-8189282 CCTCCAGCGAGGAGACTGGCGGG - Intronic
970004008 4:11393708-11393730 CCTCCAGGCAGGACAACCTCTGG - Exonic
972425511 4:38928997-38929019 GCTCCAGCAGGGACACCCCCAGG - Intronic
972516632 4:39815594-39815616 TCCCCAGCCAGGACATCCTCAGG - Intergenic
972726239 4:41748398-41748420 CCTGCAGCCTGGGCACCCTCAGG - Exonic
976428901 4:84939296-84939318 ACTCCAGATAGGACACCCTGAGG - Intronic
981927456 4:150155571-150155593 CCTCCAGAGGGGACTCCCTGAGG - Intronic
985834588 5:2261200-2261222 CCTCCAGTGAGGACTCCCAGGGG + Intergenic
997564337 5:134875346-134875368 CCTCCATCCAGGACACCCCAGGG - Intronic
999881076 5:155864407-155864429 CCTCCACCGATGTCACCCTTTGG - Intergenic
1005459554 6:26055535-26055557 CCGCCAGCGAGAAAAGCCTCCGG + Intergenic
1006837668 6:37008793-37008815 TCTCCAGGGAGGAAGCCCTCAGG + Intronic
1012356500 6:98320927-98320949 CCTCCAGCTAGGAGACAATCTGG - Intergenic
1012474202 6:99603355-99603377 CGGCCAGCGCGGACACCCTCGGG + Intergenic
1013369360 6:109455965-109455987 CCTCCAGCGGGGACAGTCTTGGG + Exonic
1019426985 7:982597-982619 CCTGGGGCGAGAACACCCTCAGG + Intergenic
1024599965 7:50971571-50971593 GCCCCAGCCAGGGCACCCTCTGG - Intergenic
1026735588 7:72946575-72946597 CCTCCAGCGACGACGGTCTCGGG - Intronic
1032431427 7:131865048-131865070 CCGCCAGCAAGCACAGCCTCTGG + Intergenic
1033232968 7:139616085-139616107 CCCCCAGCAGGGACACCCACAGG - Intronic
1033290246 7:140077253-140077275 CATCCATCGAGGTCAGCCTCTGG - Intergenic
1033568439 7:142602383-142602405 CCTCCAGGGTGCAAACCCTCTGG + Intergenic
1034749485 7:153555438-153555460 GCTCCAGTGAGGACACTCCCAGG + Intergenic
1035563516 8:626673-626695 CCTCTAGGCAGGCCACCCTCTGG - Intronic
1040578390 8:48674484-48674506 CCGCCAGCCAGGCCTCCCTCAGG + Intergenic
1048035486 8:130673596-130673618 CCTGCAGCCAGGACACCACCGGG - Intergenic
1049237287 8:141518647-141518669 CTTCCAGCGACGGCACCCCCAGG + Exonic
1049338803 8:142100881-142100903 TCTGCCCCGAGGACACCCTCTGG - Intergenic
1049491178 8:142903878-142903900 CCTCCATCGAGGTCACACTTTGG - Intronic
1049619980 8:143593684-143593706 CCTGCAGAGAGGAAGCCCTCAGG + Intronic
1056953226 9:91062363-91062385 CCTCCAGCTGTGACACCTTCAGG - Intergenic
1057194775 9:93110862-93110884 CCTCCCCAGAGGCCACCCTCTGG + Intronic
1058740832 9:107940512-107940534 TCTCCAGCCAGGACATCCTGAGG - Intergenic
1061509366 9:131051047-131051069 CCCCCAGCCAGGAAACGCTCTGG + Intronic
1061649021 9:132031167-132031189 TCTCCAGAGAGGACACCACCTGG - Intronic
1062119807 9:134828120-134828142 CCTGCAGCAAGTGCACCCTCAGG + Intronic
1062162525 9:135088058-135088080 CCACCAGCGAGGGCAGCGTCTGG - Exonic
1189801806 X:44698501-44698523 TCTCCAGCAAGGGCACCCCCAGG + Intergenic
1198313050 X:135438596-135438618 CCTCCAGCTAGTGCACCCTCTGG - Intergenic
1200059878 X:153479482-153479504 CCTCCAGGGAGGGCTCTCTCAGG - Intronic
1200800419 Y:7381829-7381851 CCTTCAGCGATGACTCCTTCAGG + Intergenic