ID: 961571769

View in Genome Browser
Species Human (GRCh38)
Location 3:127804413-127804435
Sequence CCCACAGTGACTCCCTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961571763_961571769 9 Left 961571763 3:127804381-127804403 CCACTGATCGCTTCTGCTCACTT 0: 1
1: 0
2: 1
3: 6
4: 151
Right 961571769 3:127804413-127804435 CCCACAGTGACTCCCTGAGTAGG 0: 1
1: 0
2: 4
3: 13
4: 171
961571761_961571769 28 Left 961571761 3:127804362-127804384 CCTGGCCACATGGCAGAGACCAC 0: 1
1: 0
2: 0
3: 23
4: 228
Right 961571769 3:127804413-127804435 CCCACAGTGACTCCCTGAGTAGG 0: 1
1: 0
2: 4
3: 13
4: 171
961571762_961571769 23 Left 961571762 3:127804367-127804389 CCACATGGCAGAGACCACTGATC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 961571769 3:127804413-127804435 CCCACAGTGACTCCCTGAGTAGG 0: 1
1: 0
2: 4
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961571769 Original CRISPR CCCACAGTGACTCCCTGAGT AGG Intronic
900131051 1:1087439-1087461 CCCACAGTGTCTCCCACAGCTGG + Intronic
900912955 1:5615088-5615110 CCCACAGTGACCCTCTGATGTGG - Intergenic
901744544 1:11363791-11363813 TCCACAGGGACTTCCTGAGAAGG + Intergenic
902467338 1:16626284-16626306 CCCAGGGTGCCTCACTGAGTGGG + Intergenic
903068633 1:20715626-20715648 CCCTCAGTGACGCCCTGCATGGG + Exonic
904896769 1:33823574-33823596 CCACCTGTGACTCCCTGCGTTGG - Intronic
905388116 1:37618337-37618359 TGCACAGTGACTCTCTGAGGGGG + Intronic
905771021 1:40638066-40638088 CCCAATGTGAGACCCTGAGTCGG + Intronic
906683449 1:47747099-47747121 CCCAGAGTAACACCCTTAGTAGG + Intergenic
907536920 1:55170610-55170632 CCCACAATGGCTCTTTGAGTTGG - Intronic
908472452 1:64457463-64457485 CCAAGAGTCACCCCCTGAGTGGG - Intergenic
912068683 1:105779789-105779811 CCCACAGAGAGTCCCTCACTGGG + Intergenic
912381053 1:109248546-109248568 CCCCCAGGGACTACCTGACTGGG + Intergenic
912749310 1:112272652-112272674 CCCAAAGTGACAGCCTGAGGGGG - Intergenic
913340144 1:117750643-117750665 CCCTCCATGACTCTCTGAGTTGG - Intergenic
914430092 1:147613014-147613036 CCCCCTGTGACTCCAAGAGTGGG + Exonic
915487217 1:156230100-156230122 CCAGCAGTGACTCCCTGGCTAGG + Intronic
916606702 1:166350017-166350039 CCCACAGTGGAACCCTGACTTGG - Intergenic
919822912 1:201484182-201484204 CCAATAGTGACTCCCTAAGCTGG + Exonic
919832539 1:201552235-201552257 CCCACAATGCCACTCTGAGTTGG + Intergenic
922054456 1:222027249-222027271 CCCTCAGTGAGTCCAGGAGTTGG + Intergenic
1065538725 10:26739884-26739906 CCCAAAGTGCCTCCCAAAGTGGG - Intronic
1065760313 10:28975716-28975738 CCCACTGCCACTGCCTGAGTTGG + Intergenic
1066004845 10:31136598-31136620 CTCACAGAGACCCTCTGAGTGGG + Intergenic
1067828530 10:49596799-49596821 GCCACAGTGAGCCCCTGACTTGG + Intergenic
1068447050 10:57137503-57137525 ACCACATTGGCTCCCTGACTGGG + Intergenic
1073474392 10:103743328-103743350 GCCTCAGTGACTCGGTGAGTTGG - Intronic
1073659730 10:105461603-105461625 CCCACAGTGGGTTCCTGAGCAGG + Intergenic
1073713597 10:106075184-106075206 CCCCCAGTGAGTATCTGAGTTGG + Intergenic
1075299548 10:121309580-121309602 GCCACATTGACTCCCTGAGTAGG - Intergenic
1076385736 10:130053830-130053852 CCCACAGTTTCTCCTTGAGTTGG - Intergenic
1076806376 10:132861205-132861227 CCCACTGTGGTTCCTTGAGTGGG + Intronic
1077469436 11:2750132-2750154 CCCACAGTGCCTCACTCAGGTGG - Intronic
1078045196 11:7907440-7907462 CCCACAGTGAATCCCTGGCTTGG + Intergenic
1078259111 11:9687980-9688002 CCCACAGTGATGCCCTGTGCTGG - Intronic
1079006245 11:16793386-16793408 TCCACAGTGACTCTCTGGCTGGG + Intronic
1083332430 11:61905167-61905189 CCCTCAGTGCCTCCTTGAGGAGG + Intronic
1089158348 11:116419156-116419178 CTCACAGTGACCCCATGAGATGG - Intergenic
1089790834 11:120942356-120942378 CCCACATTGACCCCTGGAGTCGG + Intronic
1090422925 11:126588134-126588156 CCCACAATGATTCCATGAGCCGG - Intronic
1093777953 12:23099344-23099366 CTCACAGTAACTCACTGAGATGG + Intergenic
1094757264 12:33485948-33485970 CACACAGTGACCCCCTCACTGGG - Intergenic
1095985019 12:47993727-47993749 TCCACAGTGTCTCCCTGGCTAGG + Intronic
1096716492 12:53494429-53494451 CCCAAAGTGACTCCATAAGGAGG + Intronic
1096850204 12:54430641-54430663 CACACAGGGACTCCCTGGGCTGG + Intergenic
1102133072 12:110548743-110548765 GCGACAGTAACTCGCTGAGTTGG + Intronic
1102504515 12:113375100-113375122 CCTGCAGTGACTCCGTGTGTTGG - Intronic
1105017409 12:132794107-132794129 CCCACAGCGGCTCCCACAGTGGG + Intronic
1105507886 13:21025881-21025903 CCAACCGTGACTCTCTGACTAGG + Intronic
1105821624 13:24085736-24085758 CCCACAGAGGCTGGCTGAGTGGG - Intronic
1110609575 13:77474108-77474130 CCTGCAGTGAATCCATGAGTCGG + Intergenic
1113421048 13:110171805-110171827 CCCACAGCGACCCCTTGAGCAGG + Intronic
1113472183 13:110554994-110555016 CCCACAGTCGCTCCCTGACACGG - Intronic
1113833662 13:113314985-113315007 TCCACACTGACTCCCTCAGGAGG - Intronic
1113899012 13:113785714-113785736 CCCACAGTCACGTCCAGAGTGGG - Intronic
1116655851 14:47653037-47653059 CCACCAGTGGCTCCATGAGTTGG - Intronic
1117643878 14:57830310-57830332 CTCACAGTGACTCAATGAGGTGG - Intronic
1120867635 14:89309357-89309379 CCCACAGTCACTCACTGGGCAGG + Intronic
1121305415 14:92903663-92903685 CCCACTCTGACTTCCTGAGCAGG + Intergenic
1122060387 14:99133228-99133250 CCGACTGTGACTCCCTGCCTTGG - Intergenic
1122364647 14:101187388-101187410 CCCACTGTCACTCAGTGAGTTGG - Intergenic
1126197465 15:45948318-45948340 CCCACAGTTTCTCATTGAGTAGG - Intergenic
1129325795 15:74799677-74799699 CCCACAGTGCCACCATGAGGAGG + Intronic
1130938400 15:88488895-88488917 GCCACAGAGTCTCCCTGAGATGG - Intergenic
1132184420 15:99791497-99791519 CCCACAGTACCTCCCTTATTGGG + Intergenic
1132205536 15:99983770-99983792 CCCTCAGAGACTCACTCAGTGGG - Intronic
1134313608 16:13098301-13098323 GCCACAGTGAATCCCTGAATGGG - Intronic
1134837504 16:17374293-17374315 CCCAAAGGGACTCCCTGACCTGG - Intronic
1135081190 16:19437360-19437382 CCCACAGGGACTGACTGTGTGGG + Intronic
1136999604 16:35217183-35217205 CCCATTGTGCCTCCCTGGGTGGG + Intergenic
1137001352 16:35233389-35233411 CCCAGTGTGCCTCCCTGGGTGGG - Intergenic
1137290306 16:47047984-47048006 CCCCCAGTGGCCTCCTGAGTGGG - Intergenic
1139477144 16:67208440-67208462 CCCACAGTCACGCCCAGAGCTGG - Exonic
1141013769 16:80428164-80428186 CTCACAGTGACAGCCTGAGAAGG + Intergenic
1142204038 16:88774201-88774223 CGCCCAGTGACTCCCTGACCAGG + Intronic
1142307557 16:89294057-89294079 CCCCCAGAGACTTCCTGGGTGGG + Intronic
1143390050 17:6555121-6555143 CTCACAGTGCCTCCCTCAGGAGG + Intronic
1148716913 17:49722469-49722491 CCCACTTTGACTCCCTGCCTAGG - Intronic
1152165279 17:78700430-78700452 TCCACAGGAACTGCCTGAGTGGG + Exonic
1152898251 17:82925876-82925898 CCCCCAGTGACACCCTGGGGTGG + Intronic
1155774260 18:29738277-29738299 TCCCCAGTGACTCCTGGAGTAGG - Intergenic
1158052966 18:53245924-53245946 CTCAGAGTGACTCCAGGAGTTGG + Intronic
1162199428 19:9009962-9009984 CACACACTCACTCCCTGAGGGGG - Intergenic
1162701857 19:12522045-12522067 CCCAGAGTAACTCCCAGAGGTGG - Intronic
1163236629 19:16033911-16033933 CCCTCACTGACTCACTGACTAGG - Intergenic
1163929501 19:20375421-20375443 CACACCATGACTCCGTGAGTTGG + Intergenic
1165310605 19:35027475-35027497 CTCACAGTGATTCCATGAGGTGG + Intergenic
1165713883 19:38031572-38031594 CCCACAATGACGCACTGAGAAGG - Intronic
1167702313 19:51056762-51056784 CCCCCAGAGTCACCCTGAGTTGG + Exonic
927853281 2:26513163-26513185 CCCATACTGATTCCCTGAGGAGG + Intronic
931239475 2:60439460-60439482 CTCTCAGTGACACCCTGAGAGGG + Intergenic
932655779 2:73610184-73610206 CCCCCAGGGACTCTCTGTGTAGG + Intronic
932891506 2:75600935-75600957 TTCACAGTCACTCCCTGTGTGGG + Intergenic
933978750 2:87533424-87533446 CCCAAAATGACTCCCTTAGGAGG + Intergenic
936315082 2:111417370-111417392 CCCAAAATGACTCCCTTAGGAGG - Intergenic
937028980 2:118722217-118722239 CCAACAGAGGCTCCCTGAGCTGG + Intergenic
937142104 2:119610932-119610954 CCAACAGTGACTCCTGGGGTAGG - Intronic
938089650 2:128423047-128423069 CCCATCGTGATTCCCTGAGCAGG - Intergenic
947278016 2:228416862-228416884 CTCCCAGTGAGTCTCTGAGTTGG + Intergenic
947793152 2:232879126-232879148 CCCACAGGGACACTCTGGGTTGG + Exonic
948083649 2:235228046-235228068 CCCACAGTGTGTCCCTGAGTGGG + Intergenic
948135938 2:235636364-235636386 CCCACAAACGCTCCCTGAGTGGG - Intronic
948565083 2:238879738-238879760 CCCACAGGTACTGCCTGTGTGGG - Intronic
948655616 2:239475285-239475307 CCCACAGTGACTCCCAGGCGAGG - Intergenic
948910914 2:241002251-241002273 CCCACAGGGACTGTCTCAGTGGG + Intronic
1170196536 20:13694657-13694679 GTCACACTGCCTCCCTGAGTTGG + Intergenic
1173867803 20:46323666-46323688 CTCCCAGTGACTCCCTGACAGGG + Intergenic
1175208458 20:57329918-57329940 CCAGCAGGGACTCCCTGTGTCGG - Exonic
1178785552 21:35649992-35650014 CACTCAGTCAGTCCCTGAGTGGG - Intronic
1179407172 21:41135901-41135923 CCCCCTGTGACTGACTGAGTGGG - Intergenic
1179501495 21:41812146-41812168 CCCCCAGAGCCTCCCAGAGTAGG + Intronic
1180701301 22:17782779-17782801 CCCTCTGTGGCTGCCTGAGTTGG - Intergenic
1181001087 22:19988046-19988068 CCCACTGAGTCTCCCTGGGTTGG - Intronic
1181570368 22:23764970-23764992 TCCACAGAGACACCCAGAGTGGG + Intronic
1184411773 22:44330336-44330358 CCCCCAGAGAGTCCCTGTGTGGG + Intergenic
949679242 3:6494145-6494167 CCCACCCTGACTCTCTGAGCTGG - Intergenic
950531849 3:13556769-13556791 CCCACAGTGACTTCGGAAGTTGG + Intronic
951176947 3:19613607-19613629 CTGACAGTGAATCCCTTAGTAGG + Intergenic
953081618 3:39625093-39625115 CTCACAGTAACCCTCTGAGTAGG - Intergenic
953724928 3:45389357-45389379 CCCACAGTGATGCCTTGAGAAGG - Intronic
954116529 3:48469686-48469708 CCCACTGTGACCCCCTGGGGTGG - Intronic
954985815 3:54790755-54790777 CCCCTAGTGACTCACTGAGCTGG + Intronic
961571769 3:127804413-127804435 CCCACAGTGACTCCCTGAGTAGG + Intronic
965669968 3:171137465-171137487 CACACAGTGACTCCCTGGAAAGG + Intronic
967120433 3:186378014-186378036 CACACACTGACACCCTGACTGGG + Intergenic
968493590 4:903486-903508 CCCACAGTGCCTCCCTGGTTCGG - Intronic
968590786 4:1458762-1458784 GCCACAGGGACTCCCTGGGGTGG - Intergenic
969573983 4:8025745-8025767 CCAACTGTGAGTCCCTGAGAGGG - Intronic
971499819 4:27306549-27306571 CTCACAGTGCCTACCTAAGTAGG + Intergenic
977089355 4:92651283-92651305 CCCACACTGAGTCCCTGATGTGG - Intronic
981645334 4:146991956-146991978 CCCACAGCGACTCCTGGAGAAGG - Intergenic
982438291 4:155402551-155402573 CAGACTGGGACTCCCTGAGTTGG + Intergenic
985498522 5:225293-225315 CACACAGTGACTCCCAGTGAGGG - Intronic
985829209 5:2215604-2215626 GCCAAAGTGACTCCCTGTGTTGG + Intergenic
986261735 5:6153346-6153368 CCCACATTGGCTCCCTGAGTGGG - Intergenic
990813210 5:59752428-59752450 CCCACAGTGAGTAGCAGAGTTGG + Intronic
993558047 5:89366638-89366660 CCCACAGAGTCTCCCTGGGGTGG - Intergenic
995041972 5:107599013-107599035 TCCACAGTGACTTCCTGACTAGG - Intronic
996628858 5:125603512-125603534 CTCTCAGTGAGTCACTGAGTGGG + Intergenic
998227097 5:140335590-140335612 GACAAAGTGACTCCATGAGTGGG + Intronic
999327736 5:150653557-150653579 ACCACAGTGCCACCCTGAGCAGG - Exonic
999327994 5:150655340-150655362 ACCACAGTGTCACCCTGAGCAGG - Intronic
1001253789 5:170168485-170168507 CCCACAAAGACTCTCAGAGTCGG - Intergenic
1007720072 6:43879568-43879590 CCCACAGTGACCAGCTGAGTTGG + Intergenic
1008540069 6:52538511-52538533 CCCACAGAGCCTCCTTCAGTTGG + Intronic
1008578332 6:52882454-52882476 CCCTCAGTAACTGCCTGAGAGGG - Intronic
1015878544 6:137847871-137847893 CCCACAGTGCCTCCCTTTCTTGG + Intergenic
1016274167 6:142328953-142328975 CCCACATTGGCTCCCTGAGATGG + Intronic
1016398051 6:143647872-143647894 CCTACAACGCCTCCCTGAGTTGG - Intronic
1018599737 6:165526405-165526427 CCCACATTGGCTCCTTGACTGGG + Intronic
1018802408 6:167234726-167234748 CACACAGTGCCACCCTGAGAAGG + Intergenic
1018808379 6:167278770-167278792 CACACAGTGCCACCCTGAGAAGG - Intronic
1019149868 6:169998041-169998063 CCCCCAGGGGCTCCCTGAGGTGG - Intergenic
1020313486 7:6887457-6887479 CCCTCACTCACTCGCTGAGTGGG + Intergenic
1022528962 7:31055088-31055110 CCCACAGTGACACACAGAGAGGG + Intronic
1022689940 7:32639047-32639069 TCCACAGTGACTGCTTGAGAAGG - Intergenic
1023131423 7:37006767-37006789 ACCACAGTGCTTCCCTGACTTGG + Intronic
1023230261 7:38020354-38020376 CCCAGAGTGACTCACTGAGTGGG + Intronic
1023900287 7:44471676-44471698 GCCTCAGTGTGTCCCTGAGTAGG - Intronic
1024255194 7:47535652-47535674 TCCACAAGGACTCCCTGAGGGGG + Intronic
1026455797 7:70571623-70571645 TCCACACTGATTCCCTGAGCAGG - Intronic
1026849976 7:73718393-73718415 CACCCAGAGGCTCCCTGAGTTGG - Intronic
1031980770 7:128122959-128122981 CCCGCAGTGAGACCCTGGGTGGG - Intergenic
1033539094 7:142339297-142339319 CTCACGGTCACTTCCTGAGTGGG - Intergenic
1033545097 7:142392459-142392481 CTCACCGTCACTTCCTGAGTGGG - Intergenic
1033681537 7:143600487-143600509 CCCATGGTGACTCCTTGAGGGGG + Intergenic
1033703355 7:143861326-143861348 CCCATGGTGACTCCTTGAGGGGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035604364 8:919969-919991 CTCCCAGTGAATCGCTGAGTGGG - Intergenic
1035873661 8:3163713-3163735 CCCACAGCTGCTTCCTGAGTGGG - Intronic
1036522599 8:9505819-9505841 ACAACAGTGAATCCTTGAGTGGG - Intergenic
1037757232 8:21718978-21719000 ACCACAGTGACTCCCTTGGATGG - Intronic
1038646473 8:29366105-29366127 CCCAGAGTGACACCCAGTGTTGG + Intergenic
1038704102 8:29878107-29878129 CCCACAGTTGCTCCCTGAGAAGG + Intergenic
1042521348 8:69714839-69714861 TGCACAGTGTCTCCCTGTGTTGG - Intronic
1043577007 8:81669424-81669446 CCCCCAGTGTCTCCATGAGGTGG + Intronic
1043925563 8:86032179-86032201 CTCAGAGTGACCCCATGAGTAGG + Intronic
1044145976 8:88714311-88714333 CCCACAAAGAATCCTTGAGTTGG + Intergenic
1044691839 8:94888470-94888492 CTCACAGTAACTCCGTAAGTAGG + Intronic
1048199282 8:132358350-132358372 GCCACAGTGACTCCCAGAGGGGG - Intronic
1048385053 8:133904377-133904399 CCCACACTGACTCCCTCCCTGGG - Intergenic
1049684170 8:143932662-143932684 CCTACCGTGACTGCCTGGGTCGG - Exonic
1062702829 9:137917018-137917040 CCAGCCGTTACTCCCTGAGTTGG + Intronic
1186170493 X:6871590-6871612 ACCACACTGTCTCCCTGAGTTGG - Intergenic
1189897662 X:45672862-45672884 CCCACAGTGACTCCTGGGGAAGG + Intergenic
1197729272 X:129796003-129796025 CTCACAGTGTCCCCCTGAGGTGG + Intergenic
1198783187 X:140258919-140258941 CCCACATTGGCTCCCTGACTGGG - Intergenic
1198933874 X:141886730-141886752 CCCACATTGGCTCCCTGACTGGG + Intronic
1200067476 X:153510804-153510826 CCCACACTGCATCCCTGAGCTGG - Intergenic