ID: 961572046

View in Genome Browser
Species Human (GRCh38)
Location 3:127806234-127806256
Sequence CACAGCCCAAGGAGAACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961572046_961572054 2 Left 961572046 3:127806234-127806256 CCTGCCGTTCTCCTTGGGCTGTG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 961572054 3:127806259-127806281 CCCTTGGAAGGCAGGGACCATGG 0: 1
1: 0
2: 0
3: 29
4: 365
961572046_961572052 -5 Left 961572046 3:127806234-127806256 CCTGCCGTTCTCCTTGGGCTGTG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 961572052 3:127806252-127806274 CTGTGAGCCCTTGGAAGGCAGGG 0: 1
1: 1
2: 20
3: 124
4: 718
961572046_961572057 4 Left 961572046 3:127806234-127806256 CCTGCCGTTCTCCTTGGGCTGTG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 961572057 3:127806261-127806283 CTTGGAAGGCAGGGACCATGGGG 0: 1
1: 0
2: 4
3: 34
4: 327
961572046_961572056 3 Left 961572046 3:127806234-127806256 CCTGCCGTTCTCCTTGGGCTGTG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 961572056 3:127806260-127806282 CCTTGGAAGGCAGGGACCATGGG 0: 1
1: 0
2: 0
3: 19
4: 275
961572046_961572051 -6 Left 961572046 3:127806234-127806256 CCTGCCGTTCTCCTTGGGCTGTG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 961572051 3:127806251-127806273 GCTGTGAGCCCTTGGAAGGCAGG 0: 1
1: 0
2: 15
3: 66
4: 458
961572046_961572050 -10 Left 961572046 3:127806234-127806256 CCTGCCGTTCTCCTTGGGCTGTG 0: 1
1: 0
2: 2
3: 17
4: 193
Right 961572050 3:127806247-127806269 TTGGGCTGTGAGCCCTTGGAAGG 0: 1
1: 0
2: 3
3: 60
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961572046 Original CRISPR CACAGCCCAAGGAGAACGGC AGG (reversed) Intronic