ID: 961575536

View in Genome Browser
Species Human (GRCh38)
Location 3:127833066-127833088
Sequence CTGGAAGGCCACACAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961575536_961575541 -3 Left 961575536 3:127833066-127833088 CCAGGTTCTGTGTGGCCTTCCAG No data
Right 961575541 3:127833086-127833108 CAGAGATCCTCTGAGGGTTGAGG No data
961575536_961575545 15 Left 961575536 3:127833066-127833088 CCAGGTTCTGTGTGGCCTTCCAG No data
Right 961575545 3:127833104-127833126 TGAGGAGAGTGGGACTTCACTGG No data
961575536_961575538 -9 Left 961575536 3:127833066-127833088 CCAGGTTCTGTGTGGCCTTCCAG No data
Right 961575538 3:127833080-127833102 GCCTTCCAGAGATCCTCTGAGGG No data
961575536_961575543 4 Left 961575536 3:127833066-127833088 CCAGGTTCTGTGTGGCCTTCCAG No data
Right 961575543 3:127833093-127833115 CCTCTGAGGGTTGAGGAGAGTGG No data
961575536_961575544 5 Left 961575536 3:127833066-127833088 CCAGGTTCTGTGTGGCCTTCCAG No data
Right 961575544 3:127833094-127833116 CTCTGAGGGTTGAGGAGAGTGGG No data
961575536_961575537 -10 Left 961575536 3:127833066-127833088 CCAGGTTCTGTGTGGCCTTCCAG No data
Right 961575537 3:127833079-127833101 GGCCTTCCAGAGATCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961575536 Original CRISPR CTGGAAGGCCACACAGAACC TGG (reversed) Intergenic
No off target data available for this crispr