ID: 961580837

View in Genome Browser
Species Human (GRCh38)
Location 3:127880760-127880782
Sequence AAACCCTGCTTCACAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961580834_961580837 30 Left 961580834 3:127880707-127880729 CCAGTCTGTTCTCATTTTGTCCA No data
Right 961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG No data
961580836_961580837 10 Left 961580836 3:127880727-127880749 CCAGTATCTCGTTTTGGTTGCTG No data
Right 961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961580837 Original CRISPR AAACCCTGCTTCACAAACAG AGG Intergenic