ID: 961588721

View in Genome Browser
Species Human (GRCh38)
Location 3:127958535-127958557
Sequence GGTATCACTCAGGATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961588713_961588721 5 Left 961588713 3:127958507-127958529 CCCAGTGCTGGGTTGACACAAAA 0: 1
1: 0
2: 1
3: 16
4: 142
Right 961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 118
961588712_961588721 14 Left 961588712 3:127958498-127958520 CCACTAAGACCCAGTGCTGGGTT 0: 1
1: 0
2: 1
3: 21
4: 139
Right 961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 118
961588714_961588721 4 Left 961588714 3:127958508-127958530 CCAGTGCTGGGTTGACACAAAAG 0: 1
1: 0
2: 0
3: 14
4: 121
Right 961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961588721 Original CRISPR GGTATCACTCAGGATCAGAT GGG Intronic
902025067 1:13376964-13376986 GGTACCACTAAGGATGTGATTGG + Intergenic
909202599 1:72710275-72710297 GGTATAAGTGAGGATCAGATTGG - Intergenic
911477783 1:98395038-98395060 ATTATCACCCAGGATCTGATAGG - Intergenic
916864369 1:168839357-168839379 GGTAAGAATAAGGATCAGATTGG - Intergenic
917776053 1:178335673-178335695 TGTATCACTCAGAATCTGAGAGG - Intronic
917776291 1:178338798-178338820 TGTATCACTCAGAATCTGAGTGG - Intronic
918465728 1:184819589-184819611 GGTAACTCTCATGATCAGCTAGG + Intronic
919811674 1:201412622-201412644 GAGAACACTCAGGATCAGAGAGG - Intronic
922898112 1:229116082-229116104 GGGGTCACTCAGGACCAGAATGG + Intergenic
923705143 1:236337820-236337842 GATATCAAGAAGGATCAGATAGG + Intergenic
1063013461 10:2049714-2049736 GATATGACTCAGAATCATATAGG + Intergenic
1063013468 10:2049758-2049780 GATATGACTCAGAATCATATGGG + Intergenic
1063013476 10:2049823-2049845 GATATGACTCAGAATCATATAGG + Intergenic
1066109353 10:32182572-32182594 GGTCTCACTCGTGATCAGAGGGG - Intergenic
1068883467 10:62075004-62075026 AGCATCAGTCAGCATCAGATGGG + Intronic
1071473552 10:86005253-86005275 GGTATCACACAGTATAAGATGGG - Intronic
1073123353 10:101134969-101134991 GGAATCAATTAGGAGCAGATGGG + Intronic
1074418828 10:113291319-113291341 GGTATCATTCAAGATCAAAGAGG - Intergenic
1074429513 10:113381778-113381800 AGTATCCATCAGGATCAGTTTGG - Intergenic
1079610112 11:22422336-22422358 GGAGTGACTCAGGATAAGATTGG + Intergenic
1085766491 11:79287657-79287679 GGTAACACTGAGGACCAGAAAGG + Intronic
1090949366 11:131459283-131459305 TGTATCACCCAGGTTCAGAAAGG + Intronic
1091405834 12:209005-209027 GGGATCACTCAGGCTGAGGTTGG - Intronic
1095129354 12:38520511-38520533 GCTTTTACTCAGAATCAGATGGG - Intergenic
1098387034 12:69930442-69930464 CGTAGGACTCAGGATGAGATAGG + Intronic
1101044976 12:100795386-100795408 GCACTCACTCAGGATCAGAAGGG + Intronic
1102416511 12:112767378-112767400 GGCATCACCCAGGATGAGAAGGG + Intronic
1109357350 13:61247702-61247724 GGTATCACTCAAGACCACAGGGG - Intergenic
1109812239 13:67528498-67528520 GGTCTCACTCTGGTTCAGACTGG - Intergenic
1110397359 13:75046802-75046824 GGTATCAGTCAGGATGAATTGGG - Intergenic
1115897842 14:38110021-38110043 ATTATCACTCAGGATTAGCTTGG + Intergenic
1120854069 14:89197630-89197652 GGATTCACCCAGGAGCAGATTGG - Intronic
1120862850 14:89270275-89270297 GGTATCACTTCGGTTCAGCTGGG + Intronic
1121320746 14:92990336-92990358 GCCATCACCCAGGACCAGATGGG + Intronic
1121449835 14:94000287-94000309 TGTGTCACTCAGGCTCAGAGAGG + Intergenic
1122394773 14:101416447-101416469 AGTATCACTCATGTTCTGATTGG + Intergenic
1124583497 15:30983909-30983931 AGTAGCACTCAGGATAGGATGGG + Intronic
1127825863 15:62702218-62702240 GCAATCACTCAGGTTCTGATGGG + Intronic
1131553214 15:93375499-93375521 TGTAACACTCAGGGTCAGCTTGG - Intergenic
1133346914 16:5077471-5077493 GGTAACACACAGGTTCAGGTGGG - Exonic
1133511103 16:6458242-6458264 GGCATCACTCAGGACCACAGAGG + Intronic
1138154816 16:54693374-54693396 AGTATCAGTCAGGATAAGCTAGG - Intergenic
1139131581 16:64152843-64152865 GCAATCACTCAGGAAGAGATTGG - Intergenic
1143028940 17:3956780-3956802 GGTATCAGTCAGGTTCAGCTTGG - Intronic
1147433671 17:40392646-40392668 GGTCTGATTCAGAATCAGATAGG - Exonic
1147810924 17:43169556-43169578 GGAAGCACTAAGGATCAGGTTGG - Intergenic
1147951429 17:44110047-44110069 GGTGTTACTCTGGCTCAGATGGG - Intronic
1149137581 17:53387810-53387832 GGTATCAGTCAGCATCTGACAGG + Intergenic
1149278334 17:55071228-55071250 GGTTTTACTCAGGGTAAGATGGG - Intronic
1153665355 18:7363248-7363270 TGTATCAATCAGGACCAGCTAGG - Intergenic
1156980434 18:43281181-43281203 GGTCTCACTTAGGAATAGATTGG - Intergenic
1158897872 18:61932148-61932170 GGTATCAGTCAGTATAAGTTAGG + Intergenic
1167687516 19:50965877-50965899 GGTTTCACTCAGCACCTGATTGG + Intronic
925389158 2:3483787-3483809 ACTATCACTCAGGATGAAATTGG + Intronic
926790040 2:16561560-16561582 GTCATCTCTCAGTATCAGATGGG + Intronic
927023402 2:19041075-19041097 GGATTCACTGGGGATCAGATTGG + Intergenic
927555841 2:24031324-24031346 GGTATTACTTAGGGTCAGGTAGG + Intronic
927735082 2:25513264-25513286 GGTATAACTTAGGTTTAGATAGG + Intronic
929558489 2:42940518-42940540 TGTATCAGTTAGGATTAGATCGG - Intergenic
932810438 2:74821094-74821116 TGTATCAGTCAGGATAAAATAGG + Intergenic
932971563 2:76549522-76549544 GGTATCAGTCATGCTCTGATTGG + Intergenic
935362563 2:102259804-102259826 GGTCTCACTCAGAATCAACTGGG - Intergenic
938464996 2:131519574-131519596 GGCATCACCCAGGATGAGAATGG + Intergenic
942964636 2:181876766-181876788 TGAATCACTCAGGATGAGACAGG - Intergenic
944482411 2:200171485-200171507 GGTATGAATCAGGAACAGTTAGG - Intergenic
945212803 2:207401178-207401200 TGTATCACTCAGGATGATTTTGG + Intergenic
945926884 2:215814907-215814929 GGTATCTCCCAGGAAAAGATTGG + Intergenic
1169347254 20:4838570-4838592 ATTCTCACTCAGGATCAGAGAGG + Intergenic
1171254108 20:23673415-23673437 GGCATCAGTCAGGATGAGCTGGG - Intergenic
1171269726 20:23804528-23804550 GGCATCAGTCAGGATGAGCTGGG - Intergenic
1172165009 20:32893618-32893640 GCTCTCACCCAGGATCAGAGTGG - Intronic
1174683299 20:52429213-52429235 TGTATCAGTCAGGATAAGCTAGG - Intergenic
1174877026 20:54237756-54237778 GGTATCTCAAAGGAACAGATCGG - Intergenic
1175592902 20:60207543-60207565 GATCTCACTCATGATCAGACCGG + Intergenic
1176912510 21:14583478-14583500 GGTAAAATTCAGGAACAGATGGG + Intergenic
1178172417 21:30056597-30056619 TGTATCCCTCAGTACCAGATGGG - Intergenic
1179341255 21:40512211-40512233 AGGTTCACTCAGGATAAGATGGG - Intronic
1181565712 22:23735992-23736014 CGTACTACTCAGGATCACATGGG - Intergenic
1181772699 22:25138051-25138073 TGTATCTGTCAGGATCAGCTAGG + Intronic
1184017033 22:41794074-41794096 GGGATCAATAAGGTTCAGATAGG + Intronic
950156321 3:10724102-10724124 GGTAACACTGAGGCTCAGAGAGG + Intergenic
952005796 3:28841148-28841170 GGTATCACTCAGGACAGGTTAGG - Intergenic
952696288 3:36268417-36268439 GGTAGCTCTCAGGATCTGAGAGG - Intergenic
954405298 3:50342048-50342070 GGTTTCAGTTAGGGTCAGATGGG + Exonic
956695366 3:71914276-71914298 GGTATCACTCAGGGTCACCCAGG - Intergenic
961545184 3:127628698-127628720 AGTCTGGCTCAGGATCAGATTGG - Intergenic
961588721 3:127958535-127958557 GGTATCACTCAGGATCAGATGGG + Intronic
967309394 3:188091684-188091706 GGTATCACTCAGAATAGGTTAGG + Intergenic
967795256 3:193592693-193592715 AGAATCTCTGAGGATCAGATGGG - Intronic
975354030 4:73378769-73378791 GGTGTAACTCAAGATCATATAGG + Intergenic
976086632 4:81413564-81413586 TGTATCAATCAGGATAAGTTAGG + Intergenic
977622765 4:99155715-99155737 GGTGTCACTCTGGATCACCTAGG - Intronic
980446465 4:132915530-132915552 TGCATCACTCAGGAGCACATTGG + Intergenic
980665730 4:135931558-135931580 TGTATCACTCAGGATAAGCTAGG + Intergenic
983767745 4:171507002-171507024 GGTAACACCGAGGAACAGATTGG - Intergenic
985864524 5:2503856-2503878 TGTAGCAGTCAGGATCAGCTAGG - Intergenic
990275888 5:54195965-54195987 GGTAGCACACAGGAGAAGATGGG - Intronic
990917574 5:60927228-60927250 GGTGTCACTGAAAATCAGATTGG - Intronic
992458760 5:76940955-76940977 TGTTTTACTCATGATCAGATTGG + Intergenic
994172374 5:96671498-96671520 GATACCACTCAGGATTACATGGG - Intronic
997074044 5:130651328-130651350 GGTATCACCCAGGACCAACTTGG + Intergenic
999091429 5:148939613-148939635 TGTATCAATCAGGATAAGCTAGG - Intronic
999525398 5:152400129-152400151 GGTAGCACTCAGGACCACATAGG + Intronic
1003958763 6:11190363-11190385 GGTTTGACTCAGGATCTGGTGGG + Exonic
1006444162 6:34069556-34069578 GGTCACACGCAGGAGCAGATGGG - Intronic
1011389866 6:86839668-86839690 TGTATCAGTCAAGATTAGATAGG - Intergenic
1015984917 6:138875219-138875241 GGAAGCACTCAGGCTCAGGTGGG + Intronic
1016443154 6:144105616-144105638 GTTATCACTAAGGAACAGAAAGG - Intergenic
1016742751 6:147545991-147546013 GGTATTATTCAGGATAAGGTAGG + Intronic
1020341887 7:7120447-7120469 GGTATCACTACGGATCATATTGG + Intergenic
1020498124 7:8882223-8882245 GGTTCCACTCAGTATCAGCTGGG - Intergenic
1027451220 7:78333841-78333863 GATCTCACTCAGGATCAGGCAGG - Intronic
1029545935 7:101210619-101210641 GGTATCACCCCGGATCACATAGG + Exonic
1034828578 7:154289380-154289402 GGTCAAAGTCAGGATCAGATGGG - Intronic
1034895244 7:154872248-154872270 GGCATCTCTCAGCATCTGATCGG - Intronic
1038462768 8:27730511-27730533 GGTCTCACTCAGGCTCAGGCTGG + Intergenic
1038481226 8:27903023-27903045 GGCATGATTCAGGATCAAATAGG - Intronic
1041334980 8:56772017-56772039 GGGTTTACTCAGAATCAGATGGG + Intergenic
1046045740 8:108962424-108962446 GGTATCACGCTAGATCAGCTTGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048799039 8:138179396-138179418 GGTATCTGGCAGGATTAGATAGG - Intronic
1051708436 9:19905129-19905151 GGTGTCATTCAGGATCTGACAGG + Intergenic
1057571163 9:96205048-96205070 TGTATCAGTCAGGATAAGCTGGG - Intergenic
1057810190 9:98251648-98251670 GATATGACTCAGGATTAGTTAGG - Intronic
1195603921 X:106780526-106780548 GGTATCTCTTAGGATTAGAGAGG + Intronic
1197248425 X:124190024-124190046 TGTATCATTCAGGATAAGCTAGG - Intronic