ID: 961588939

View in Genome Browser
Species Human (GRCh38)
Location 3:127960373-127960395
Sequence CAAATGCAAAATATATACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961588939 Original CRISPR CAAATGCAAAATATATACCC TGG (reversed) Intronic
900670133 1:3847474-3847496 CAAATACAACATATATAATCAGG - Exonic
901075691 1:6553679-6553701 AAAATACAAAAAATATAGCCGGG + Intronic
903209826 1:21811523-21811545 CATGTGTAAAATAAATACCCTGG - Intergenic
903213364 1:21830527-21830549 AAAATGCAAAAAATTTAGCCAGG + Intronic
904152127 1:28450586-28450608 CAAAAACAAAAAATATACTCAGG - Intronic
904669061 1:32148715-32148737 AAAATACAAAAAACATACCCAGG - Intronic
905581184 1:39083426-39083448 CCAAACCAGAATATATACCCAGG + Intronic
906931377 1:50172987-50173009 CAAATGCAAAATTAATTCCCTGG + Intronic
908304872 1:62802147-62802169 GATATGCCAAAGATATACCCAGG - Intronic
908869034 1:68586812-68586834 GAAATACAAATTATATCCCCTGG + Intergenic
909289045 1:73858968-73858990 CAAATGCAAAAAAATTAGCCAGG - Intergenic
910299608 1:85691051-85691073 AAAATGCAGAATAGATACCCGGG - Intronic
911245517 1:95512121-95512143 CAAATGCAAAACATTTCCCTAGG + Intergenic
912438187 1:109676644-109676666 AAAAAGCAAAAGATATAGCCAGG - Intronic
912916565 1:113821480-113821502 AAAATACAAAAAATTTACCCAGG - Intronic
913468340 1:119165908-119165930 AAAATACAAAATATTTAGCCAGG + Intergenic
914903421 1:151724958-151724980 AAAATGCAAAATAATTAGCCGGG - Intronic
915707018 1:157853977-157853999 CAAATGCAAAATATACTACAAGG + Intronic
916569977 1:166016742-166016764 AAAATGCAAAAAAAATAGCCAGG - Intergenic
917561895 1:176167101-176167123 AAAATGCAAGGTATATACACTGG + Intronic
918189261 1:182156332-182156354 CAAATCCAAAATCCATACACAGG - Intergenic
919283630 1:195524028-195524050 AATATGCAATATATATACCATGG + Intergenic
920320609 1:205119232-205119254 AAAATACAAAAAATATAGCCAGG + Intronic
920578492 1:207082152-207082174 AAAATGAAAAATAAATAGCCAGG - Intronic
922859048 1:228799909-228799931 CAAATCCAAACCATATCCCCAGG - Intergenic
923583308 1:235239756-235239778 AAAATGCAAAATATTCAACCTGG + Intronic
924058764 1:240149772-240149794 CCACTGCAAAATATATTCACAGG + Intronic
924063677 1:240202621-240202643 AAAATGGAAAATAAATAGCCAGG - Intronic
924279259 1:242419554-242419576 AAAATGCAAAAAATTTAGCCGGG - Intronic
1063343444 10:5290249-5290271 AAAATGCAAAAAATTTAGCCGGG - Intergenic
1063930472 10:11023567-11023589 TAAATGAAAAATACATTCCCAGG - Intronic
1064266817 10:13832028-13832050 CAAAAGCAAAATGAAAACCCTGG + Intronic
1068844697 10:61658823-61658845 GAAATCCACAATAAATACCCAGG + Intergenic
1069337501 10:67370557-67370579 CAGATGTAAAATGTATAACCAGG - Intronic
1069663715 10:70140725-70140747 CAAAACCAAAACATATACCTTGG + Intronic
1070935214 10:80288812-80288834 CACATGCAAAATATATGATCAGG - Intronic
1071107910 10:82120219-82120241 AAAATGCTAAATATACACCCAGG + Intronic
1071589168 10:86855651-86855673 CAATTGCAAATTAGATACTCAGG - Intronic
1074374752 10:112930614-112930636 AAAATGCAAAAAAAATAGCCAGG + Intergenic
1074665627 10:115720018-115720040 AAAATACAAAAAATATATCCAGG - Intronic
1074727036 10:116321691-116321713 CCATTGCAATATATATGCCCTGG + Intergenic
1075586024 10:123658855-123658877 AAAATGAAAAATAAATAGCCAGG + Intergenic
1076217301 10:128706055-128706077 TAAATGGAAACTATATACACTGG - Intergenic
1079876493 11:25864337-25864359 CAAATGAGAATTATTTACCCTGG + Intergenic
1080100009 11:28448922-28448944 CAAATGCAAATTATTTCCACAGG - Intergenic
1081318177 11:41656994-41657016 CAAATTCAAACTATTTAGCCAGG - Intergenic
1081337325 11:41882730-41882752 TAGATGCCAAATATATACCTGGG - Intergenic
1081824366 11:46033732-46033754 CAAGTGTAAAATATAAACACCGG + Intronic
1082685000 11:56227239-56227261 CCACTACAAGATATATACCCAGG + Intergenic
1083404951 11:62450316-62450338 CAAATACAAAAAAAATAGCCGGG - Intronic
1085816509 11:79742795-79742817 CAAATATAAAATCTATCCCCTGG - Intergenic
1086293882 11:85343165-85343187 CAAATGCAATACATAAACCTGGG - Intronic
1086436276 11:86784101-86784123 CAAATGCAAACTCTCTTCCCTGG + Intergenic
1086837646 11:91645001-91645023 CAAAGGCAAAATCTGAACCCAGG + Intergenic
1087267848 11:96080371-96080393 AAAATGCAAAAGCTATTCCCTGG - Intronic
1087536381 11:99451823-99451845 CAAATGCAAAATTCATTCCACGG - Intronic
1088685478 11:112281301-112281323 AAAATGCAAAACAATTACCCAGG - Intergenic
1090701575 11:129300700-129300722 CATCTGCAAAATACATAACCAGG - Intergenic
1091599515 12:1909350-1909372 AAAATGCAAAAAATTTAGCCGGG - Intronic
1092847438 12:12596765-12596787 CAAGTGCAACATATACACCACGG + Intergenic
1092944759 12:13442460-13442482 TAAATGCAAAATATAATCCTGGG - Intergenic
1093393272 12:18649789-18649811 CAAATGAAGAAAATATATCCAGG - Intergenic
1093515878 12:19986508-19986530 CAAAAGCAAAATGTGTGCCCTGG + Intergenic
1094009106 12:25787654-25787676 CAAATGAAAAATCTATACGTTGG - Intergenic
1094125591 12:27019577-27019599 CAAATACAAAAAACTTACCCAGG + Intergenic
1094696449 12:32823759-32823781 AAAATACAAAAAATATAGCCGGG - Intronic
1094796452 12:33978953-33978975 CTAATCCAAAGCATATACCCTGG + Intergenic
1095109011 12:38270954-38270976 CTAATCCAAAGCATATACCCTGG + Intergenic
1097720666 12:63016949-63016971 CAAAAACAAACAATATACCCCGG + Intergenic
1099164767 12:79290521-79290543 CAAATGCAAGAAGTATAACCAGG - Intronic
1100517272 12:95340383-95340405 CAAAGGCACAATATAATCCCAGG - Intergenic
1102154436 12:110713291-110713313 AAAATGCAAAATAATTAGCCGGG - Intergenic
1102372245 12:112391809-112391831 AAAATTCAAAATATTTAGCCAGG - Intergenic
1102373485 12:112401931-112401953 CAAATGCAAACTATAGACTTTGG - Intergenic
1103220980 12:119244976-119244998 GAAATGCAAAATATCTACAATGG - Intergenic
1103458150 12:121083372-121083394 CCAATGCTAGATATATATCCAGG + Intergenic
1103768894 12:123304392-123304414 AAAATGCAAAATATTATCCCAGG - Intronic
1105881217 13:24607972-24607994 AAAATGCAAAAAAAATAGCCGGG + Intergenic
1105967628 13:25399087-25399109 CACATGCAGATTAGATACCCAGG - Intronic
1106381399 13:29243386-29243408 CAAATGCAGCATAAAGACCCAGG + Intronic
1108566542 13:51704672-51704694 CAGATGTAAAATATATAGGCTGG - Intronic
1109611966 13:64777652-64777674 AAAATGCAAAACTTATTCCCTGG + Intergenic
1110237681 13:73233540-73233562 AAAATAGAAAATATATAGCCGGG - Intergenic
1110856004 13:80297309-80297331 CAAATGCAAAATAACCAGCCAGG + Intergenic
1111154727 13:84307872-84307894 AAAATGCAAAAAATTTAGCCGGG + Intergenic
1111457492 13:88504095-88504117 CAAATGAAAAAAATATTCCATGG - Intergenic
1112855231 13:103760499-103760521 CAAATCCAAAACATATCACCAGG - Intergenic
1113427161 13:110218064-110218086 CAAATACAAATCAAATACCCAGG + Intronic
1115006095 14:28486869-28486891 CTGATGTAAAATATATTCCCTGG - Intergenic
1116130355 14:40848139-40848161 AAAATACAAAAAAAATACCCGGG + Intergenic
1116767508 14:49090759-49090781 ATAATGGAACATATATACCCTGG + Intergenic
1121852389 14:97233607-97233629 CAAATGAAAACTATATGCTCAGG + Intergenic
1124029133 15:25993592-25993614 CATGTGCAAAAAATATTCCCTGG - Intergenic
1125277888 15:38012606-38012628 CAAATACACAATATGTACTCAGG + Intergenic
1127621765 15:60740994-60741016 CAATTGCAAAATATAAGCCTAGG + Intronic
1128886135 15:71289816-71289838 AAAAGTCAAAATAAATACCCTGG + Intronic
1128953674 15:71915950-71915972 CAAAGGTAAAATAAATACACAGG + Intronic
1129885350 15:79033130-79033152 GAAAGGCAAAGTATATACCCAGG - Intronic
1131391516 15:92052763-92052785 CAAATGTAAAATTTATACATAGG + Intronic
1131940090 15:97553031-97553053 GAAATGCAAGATATATTGCCAGG - Intergenic
1132013397 15:98295323-98295345 CAAATGCGAAATAAGCACCCTGG - Intergenic
1132204997 15:99980437-99980459 CTACTGCAAAACATGTACCCAGG + Intronic
1132248895 15:100318675-100318697 CAAATGCAAAATAAACAAACGGG + Intronic
1135074000 16:19377622-19377644 CATTTCCAAAATATATATCCTGG - Intergenic
1136231695 16:28889415-28889437 CAAATGCAAAAAAATTAGCCAGG - Intronic
1139117513 16:63974952-63974974 CAAATGTAAAAAAGATACACAGG + Intergenic
1141492362 16:84382733-84382755 AAAATGCAAAACATTTAGCCAGG + Intronic
1142610236 17:1105412-1105434 AAAATGCAAAATATAGATCGAGG + Intronic
1143306137 17:5948274-5948296 AAAATACAAAAAAAATACCCAGG - Intronic
1144048869 17:11480254-11480276 TAAATGCAAAAAATACACCTAGG - Intronic
1146340689 17:32017320-32017342 CAAATCCAAAATAGAGACCATGG - Intronic
1146434617 17:32832598-32832620 CAAATGCAAAATACATAATTAGG - Intronic
1147867311 17:43561579-43561601 CACATGCAAAACATTTAGCCTGG - Intronic
1148244148 17:46019525-46019547 GAAATACAAAATATTTAGCCAGG - Intronic
1149020869 17:51962519-51962541 CAAGAATAAAATATATACCCAGG + Intronic
1149536722 17:57438958-57438980 AAAATGCAAAACAAATAGCCGGG - Intronic
1149569432 17:57661957-57661979 CACATGCAAAATATCTTCCAAGG - Intronic
1151920929 17:77154993-77155015 AAAATGCAAAATATACAACTGGG - Intronic
1153461606 18:5340081-5340103 CAAGTGCAAAATTCATACACTGG - Intergenic
1153500748 18:5746973-5746995 TAAATACAAAATGTCTACCCGGG + Intergenic
1153554737 18:6299828-6299850 CAAATACAAAAAAAATAGCCGGG - Intronic
1155439399 18:25845597-25845619 GAAATAAAAAATATATACCTAGG - Intergenic
1156020856 18:32597892-32597914 CAACTGCAGAATTTATACCAAGG - Intergenic
1156692899 18:39729759-39729781 CAAATGGCATATATATACCAAGG + Intergenic
1157348577 18:46863590-46863612 TAAATGAAAAATTTATTCCCAGG - Intronic
1159552483 18:69909682-69909704 CAAATCCAAAATAAATACCATGG - Intronic
1159783868 18:72691875-72691897 AAAATGCGAAACATATACCTAGG - Intergenic
1160908477 19:1463255-1463277 CAAATACAAAAAAAATAGCCAGG + Intronic
1162894287 19:13755795-13755817 CAAATACAAAAAAAATAGCCGGG + Intronic
1163065599 19:14791374-14791396 CAAGTTGAAAATATATAACCAGG - Intergenic
1163214837 19:15868841-15868863 AAAATACAAAATATGTAGCCAGG - Intergenic
1163215395 19:15872781-15872803 AAAATACAAAATATGTAGCCAGG - Intergenic
1163611942 19:18306183-18306205 TAAATGCAAAATCTATACGATGG + Intergenic
1165553986 19:36613733-36613755 AAAAAGCAAAATATACAGCCGGG - Intronic
1166555178 19:43694545-43694567 CAAAAGCACAAAATATACACAGG + Intergenic
1167425329 19:49427230-49427252 AAAATGCAACAGATGTACCCAGG + Exonic
1168190818 19:54737612-54737634 CAAATAAAAATTATATACCATGG - Intronic
1168723175 19:58565978-58566000 AAAATACAAAATATTTAGCCAGG + Intronic
925268871 2:2588016-2588038 AAAATGCAAAATAATTAGCCAGG + Intergenic
926280255 2:11440358-11440380 CAAAAGCAAAACATAAAGCCAGG + Intergenic
926730576 2:16032968-16032990 AAAATGCAAAAAATTAACCCAGG - Intergenic
927556715 2:24039676-24039698 CAAATGCAATGTATATACTTTGG + Intronic
927830307 2:26344670-26344692 AAAATGCAAAAAATTTAGCCGGG + Intronic
928571190 2:32610617-32610639 CAAATGCTAAATAAGTAACCAGG - Intronic
928797765 2:35043687-35043709 CAAATGCAAGATATATATGCAGG - Intergenic
929047376 2:37803080-37803102 AAAAAGCAAAATAAATAACCAGG + Intergenic
929214568 2:39398044-39398066 AAAATGCAAGATATATATACAGG + Intronic
929832840 2:45362240-45362262 TAAATGAAGAATACATACCCCGG + Intergenic
930123097 2:47775925-47775947 CAAGTGCAAAAAATTTACCCAGG + Intronic
930479882 2:51934417-51934439 GATATGCAAAGTATATGCCCAGG - Intergenic
930579433 2:53192577-53192599 CAACTTCAAAATATTTCCCCAGG + Intergenic
930827801 2:55711874-55711896 AAAATGCAAAAAATTTAGCCAGG - Intergenic
933130747 2:78672266-78672288 CATCTGCAAGATACATACCCAGG + Intergenic
933468175 2:82683160-82683182 TATATACAAAATAAATACCCTGG + Intergenic
935643474 2:105312391-105312413 AAATTTCAAAATACATACCCAGG + Intronic
936174496 2:110207836-110207858 AAAATGACAAATATATACCTTGG + Intergenic
936599136 2:113878480-113878502 CAAATGAAAAATAAAAACACTGG - Intergenic
936837845 2:116729188-116729210 CATATACAAAATATATATGCTGG + Intergenic
937178634 2:119968629-119968651 AAAATGCAAAAAAAATAGCCGGG + Intronic
937891014 2:126938809-126938831 CAAATGCCAATTAAAAACCCAGG + Intergenic
938538987 2:132270109-132270131 AAAATACAAAAAATATAGCCAGG + Intergenic
939667763 2:144971304-144971326 CAATGGAAAAATATATACCTGGG + Intergenic
941883510 2:170505093-170505115 CAAACGGAAAAAAAATACCCTGG + Intronic
943078942 2:183233282-183233304 CAAATTGAGAATATATACCATGG - Intergenic
943263412 2:185695577-185695599 AAGATGGAATATATATACCCAGG + Intergenic
944289507 2:197989495-197989517 GAAATGCAAATTATCTAGCCTGG - Intronic
944396105 2:199268116-199268138 GAAAGGCAAAATATAAATCCAGG - Intergenic
944974789 2:205037542-205037564 CATATGTAAAATATATACAGTGG + Intronic
945114532 2:206398213-206398235 CAACTGCAAAACTTATACACAGG + Intergenic
945611855 2:212013421-212013443 CCAATTCAATATATTTACCCAGG - Intronic
945714697 2:213343974-213343996 CAAATTCAAATTATTTACTCAGG + Intronic
945888999 2:215408726-215408748 AAAATGCAAAAAAAATAGCCGGG - Intronic
946369984 2:219274891-219274913 CAAATGAAAAATAGAGACCGAGG - Intronic
946537617 2:220648413-220648435 AATATGAAAAATATATACCCGGG - Intergenic
1169435140 20:5580563-5580585 CAAATACAAAAAAAATAGCCGGG + Intronic
1169669994 20:8088181-8088203 CAAATGCAAAATAAATAGCAAGG - Intergenic
1169717477 20:8636671-8636693 CAAATGCAGAAAAGACACCCAGG - Intronic
1169884239 20:10381032-10381054 CAAATGCAACATATAGTCTCTGG - Intergenic
1170171400 20:13417254-13417276 CAAAAGCAAAATAGATATGCTGG + Intronic
1170928793 20:20749500-20749522 CACATGCAAAAGAGCTACCCAGG + Intergenic
1170929523 20:20756308-20756330 AAAATGCAAAAAAAATAGCCAGG - Intergenic
1173677183 20:44846038-44846060 AAAATGAAAAATCTATTCCCTGG - Intergenic
1174319748 20:49731992-49732014 AAAATGCAAAAAAATTACCCGGG + Intergenic
1175098792 20:56563353-56563375 CATATACAAAACATATATCCTGG - Intergenic
1177439602 21:21104319-21104341 CAAATGCAAAATACATAGGATGG + Intronic
1177476495 21:21630788-21630810 CAATTGCAACAAATATACCCCGG + Intergenic
1177513216 21:22117029-22117051 CAACTTCAACATCTATACCCAGG - Intergenic
1177828751 21:26113081-26113103 GAAATGAAAAATATATCCACAGG + Intronic
1178824938 21:36006886-36006908 AAAATGCAAAAAAGATAGCCAGG + Intergenic
1178844464 21:36162847-36162869 CAACTGCTAAATACATTCCCTGG - Intronic
1183875222 22:40774596-40774618 CAAAAGAAAAAAATATGCCCAGG + Intronic
949771177 3:7579867-7579889 TATATGCACAATATATACCCAGG + Intronic
949881280 3:8662928-8662950 CAAATGCAAAATAAGTACCAAGG + Intronic
950298958 3:11857357-11857379 CAAATCCTAGATATTTACCCTGG - Intergenic
951068065 3:18290838-18290860 CAAAAGGGAAATATATTCCCAGG - Intronic
951740111 3:25912199-25912221 CAAATGCAAAGTATATTAACAGG + Intergenic
951916818 3:27809627-27809649 CAACTGCATAATATGTATCCTGG + Intergenic
951941562 3:28085055-28085077 CAAATCCAGAATATTTAACCAGG - Intergenic
957399547 3:79691078-79691100 CAAGTGCAGGATATAAACCCAGG + Intronic
957484369 3:80839056-80839078 CAAAAGCAAAATAATTATCCTGG + Intergenic
957827823 3:85471670-85471692 AAAATGCTAAAAATATAACCAGG - Intronic
958096630 3:88954256-88954278 CAAATATAAAATATAGACACTGG + Intergenic
959858999 3:111195443-111195465 CAAAAGCATACTATAGACCCAGG + Intronic
959881897 3:111453461-111453483 AAAATGTAACATATATACCATGG + Intronic
960145972 3:114203055-114203077 CAAAAGAAAAATATAAACTCAGG - Intergenic
961588939 3:127960373-127960395 CAAATGCAAAATATATACCCTGG - Intronic
963533829 3:146503354-146503376 CAAATGGAAAATATATACCCTGG - Intergenic
964129672 3:153272792-153272814 GATATGCAAAAAATATATCCAGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968032568 3:195513302-195513324 AAACTGCAAAATATATATTCAGG - Intergenic
969937846 4:10700375-10700397 CCAAAGCCAAATATATATCCAGG + Intergenic
970213330 4:13733182-13733204 AAAATACAAAATAAATAGCCGGG - Intergenic
970366177 4:15360351-15360373 CAATTGCCAAAAATATAACCAGG - Intronic
970764446 4:19530952-19530974 AAAATGCAAAATACATTGCCGGG + Intergenic
971688945 4:29808509-29808531 CACTTTCAAAATATATATCCAGG + Intergenic
972049550 4:34711926-34711948 AAAATGCCAAAAATATACACTGG + Intergenic
972096609 4:35354859-35354881 AAAATGCAAAAAATTTAGCCGGG + Intergenic
973657837 4:53068540-53068562 AAAATTAAAAATATATACACAGG - Intronic
974131329 4:57760039-57760061 CATAAGCAAAACATGTACCCTGG - Intergenic
974244219 4:59292867-59292889 CAGCTACAAAATATGTACCCAGG - Intergenic
974503861 4:62741540-62741562 CAAATGCAAAATAAATTTACAGG - Intergenic
976011754 4:80497107-80497129 CACATGCAAACTATATAAACAGG + Intronic
978485289 4:109246866-109246888 AAAATGCACAAAATATGCCCTGG + Intronic
978895396 4:113880703-113880725 CAAATTAAAAATATATAACTAGG + Intergenic
978962253 4:114695396-114695418 TAAATGGAAAATATATACACAGG - Intergenic
979406681 4:120320365-120320387 GAAATTCAAAATATACACACAGG - Intergenic
980461608 4:133122613-133122635 CAAATGTAAAACATATAGCTAGG + Intergenic
980639828 4:135563197-135563219 CAAATACAAAAAATTTAGCCAGG + Intergenic
982081781 4:151797221-151797243 CAAATGCTATATATGTGCCCAGG - Intergenic
984141064 4:176004325-176004347 GGAATGCAAAATTCATACCCAGG + Intergenic
985112903 4:186564262-186564284 AAAATGCAAAAAATTTAGCCGGG - Intergenic
985233032 4:187842246-187842268 AAAATGCAAAAAATTTAGCCAGG + Intergenic
985878277 5:2617671-2617693 CAAATGCAAGAGACATACCTGGG - Intergenic
986889836 5:12289024-12289046 AAAATGCAAAATATATCACTTGG + Intergenic
987216915 5:15747194-15747216 TATATGCAAAATAGATCCCCAGG + Intronic
988420167 5:30995941-30995963 CAAATCCTAAATTTATATCCTGG + Intergenic
988467547 5:31504978-31505000 CAAAAGCAAATTTTATATCCTGG + Intronic
988791985 5:34617108-34617130 CAGGTGCTAAATATATAGCCTGG + Intergenic
988899425 5:35716539-35716561 CAACAGCAAAATATATACATTGG + Intronic
989352736 5:40505342-40505364 CAAATGCTAAGGAAATACCCAGG - Intergenic
990324823 5:54664641-54664663 CAACAGCAAAAAATAAACCCTGG + Intergenic
990751858 5:59024836-59024858 GAAAATCAAAATATATACCAAGG + Intronic
994488872 5:100416183-100416205 AAAATGTAAAATATATTTCCAGG + Intergenic
995095737 5:108233847-108233869 CAAATGAAAACCAGATACCCAGG + Intronic
995761786 5:115570404-115570426 CAAATACAAAATATCTCCACGGG + Intergenic
995873744 5:116768654-116768676 CTTATGCAAAATATATACCAGGG - Intergenic
995956776 5:117786073-117786095 CAAATGACAAATATATAGCGAGG - Intergenic
996280012 5:121718839-121718861 CAAATGTAAAATATATAATCTGG - Intergenic
999146151 5:149396595-149396617 AAAATACAAAAAATATAGCCAGG + Intronic
999555145 5:152733070-152733092 CAAAATGAAAATATATACCATGG - Intergenic
999741981 5:154562611-154562633 TAACTGCAAACTATATTCCCAGG + Intergenic
1000816100 5:165923641-165923663 CAAAAGCAAAATAAATACTTTGG - Intergenic
1001488117 5:172134549-172134571 CAAAGAAAAAATAGATACCCTGG + Intronic
1001735839 5:173999749-173999771 AAAATGAAAAATATAGACACAGG + Exonic
1003648054 6:7931867-7931889 CAACAACAAAATATATACCTAGG + Intronic
1004761617 6:18673001-18673023 GAAATGGAAATTATTTACCCTGG + Intergenic
1005787826 6:29264268-29264290 TAAGTGTAAAATTTATACCCAGG + Intergenic
1008549716 6:52616514-52616536 CACATGACAAATATATCCCCTGG + Intergenic
1011273738 6:85606616-85606638 CAAATGCTAAATAAATCTCCAGG + Intronic
1012678361 6:102146200-102146222 AAAATGCAATATATATGCCATGG - Intergenic
1013019777 6:106202432-106202454 CAAATACAAAACATAAACCATGG + Intronic
1013173858 6:107661082-107661104 CAAAAGCAAAATCAATATCCTGG - Intergenic
1013916111 6:115338911-115338933 CAAAAGCAAAATATAGAACATGG - Intergenic
1014656954 6:124118800-124118822 CAAAACCAAAATATTTACTCCGG - Intronic
1015668515 6:135659792-135659814 CAAAGGCAAAATGTAAACCAAGG - Intergenic
1016234767 6:141850787-141850809 TAAATATAAAATATATACCAGGG + Intergenic
1017226448 6:152027981-152028003 AAAATACAAAAAATATAGCCAGG + Intronic
1017577574 6:155822158-155822180 CAAAGGCAAAATTTAAACTCAGG + Intergenic
1018408930 6:163521302-163521324 CAACTGAAAAATATATAGACAGG - Intronic
1018585896 6:165358534-165358556 CAAATGATAAAGATATACCATGG - Intronic
1018834877 6:167475149-167475171 CAAATGCAAAATTTATAAACAGG + Intergenic
1019797042 7:3057972-3057994 AAAATGCAAAAAATTTAGCCAGG + Intergenic
1020588887 7:10108809-10108831 GAAATGCAAAATAGATGCCTGGG - Intergenic
1021610283 7:22451034-22451056 CAAATGCAAAAAAATTAGCCAGG + Intronic
1022548756 7:31215567-31215589 CAAATGGAAAATCAATAGCCAGG - Intergenic
1024627254 7:51218632-51218654 AAAATGCAAAATAATTAGCCAGG - Intronic
1024935131 7:54704212-54704234 CAAATACAAAATATCTACACAGG - Intergenic
1026352356 7:69528564-69528586 AAAATGCAAAAAAATTACCCGGG - Intergenic
1029387239 7:100251364-100251386 AAAATACAAAAAAAATACCCGGG + Intronic
1029447627 7:100622796-100622818 CAAATACAAAAAATTTAGCCAGG + Intronic
1030314147 7:108097248-108097270 CAAATGGAAATTATTTACCCAGG + Intronic
1030464588 7:109884364-109884386 CAGATACAAAATATAAACTCTGG + Intergenic
1030853394 7:114519307-114519329 CAAATCCAAAATACACACTCAGG - Intronic
1031774119 7:125885117-125885139 TAACTGGAAAATATATACACAGG - Intergenic
1031986482 7:128167398-128167420 GAAAGGCAAAATATAGAACCCGG - Intergenic
1032135210 7:129270453-129270475 CAAATGTAAAACATATAACAAGG - Intronic
1032677016 7:134140263-134140285 AAAATGCAAAATGTAGGCCCGGG - Intronic
1033808202 7:144978373-144978395 CAAGGACAATATATATACCCTGG - Intergenic
1033834564 7:145293462-145293484 AAAATGCAAAATAAAAACACAGG - Intergenic
1033948697 7:146756563-146756585 CAAATTCAATATATACACACGGG + Intronic
1035681255 8:1490050-1490072 AAAATGCAAAAAAAATAGCCGGG - Intergenic
1036467706 8:9017015-9017037 TAAATGCAAAATATAAAGTCAGG - Intronic
1036556419 8:9863860-9863882 CCAAAGCCAAATCTATACCCAGG - Intergenic
1037166880 8:15841045-15841067 CTAATGGAAAATATAAACACAGG - Intergenic
1040961717 8:53041085-53041107 CATATGCAAAATATTGACACTGG - Intergenic
1041499543 8:58525200-58525222 CTATTGCAGAATATATAGCCAGG + Intergenic
1042099522 8:65259709-65259731 CAAAAGGAAAATATATGCACAGG + Intergenic
1042912446 8:73841674-73841696 CAATGGCAGAGTATATACCCCGG + Intronic
1044187195 8:89267999-89268021 AAAATGTAAAATATATAGACAGG + Intergenic
1044357513 8:91240757-91240779 CAAAAGAAAAATATATTCCCTGG + Intronic
1045129647 8:99135566-99135588 CAAATGCAAAATTTATAAATGGG - Intronic
1046212936 8:111102222-111102244 CACATGCAAAATACATTACCTGG + Intergenic
1046471753 8:114684126-114684148 CAAATACAAATAATATACTCTGG - Intergenic
1046471906 8:114686422-114686444 CAAATGCAAATCATATACTCTGG - Intergenic
1046974737 8:120261854-120261876 CAATTGCAAAAGACATTCCCAGG - Intronic
1047447856 8:124935994-124936016 CAAAGTCAAAATATGTCCCCAGG - Intergenic
1049857780 8:144874468-144874490 CAAATGCAAAGTATTAATCCTGG + Intergenic
1050711489 9:8470391-8470413 CAAATACTAAATATATAACGTGG - Intronic
1052051941 9:23859028-23859050 AAAATGAAAATTATCTACCCAGG - Intergenic
1052647974 9:31262134-31262156 AAAATGCAAAAAACATAGCCGGG + Intergenic
1053438390 9:38093284-38093306 GAAAAGAAAAATATATACTCGGG - Intergenic
1053547078 9:39034463-39034485 AAAATACAAAAAATATAGCCAGG + Intergenic
1053811395 9:41856132-41856154 AAAATACAAAAAATATAGCCAGG + Intergenic
1054619199 9:67331307-67331329 AAAATACAAAAAATATAGCCAGG - Intergenic
1054813598 9:69454319-69454341 AAACTGAAAAATATATACCTGGG + Intronic
1054969539 9:71069335-71069357 AAAATGCAAAAAATTTAGCCAGG - Intronic
1055048506 9:71955685-71955707 CAAACTTAAAATATGTACCCAGG + Intronic
1055105106 9:72504069-72504091 CCAATACAAAATATGTTCCCAGG - Intergenic
1055611260 9:78027588-78027610 TAAATGCAAAAAAAATAGCCGGG + Intronic
1057175017 9:92989959-92989981 TAACTGCAAAATAAATACCTAGG - Intronic
1057362349 9:94385245-94385267 CAAAGTCAAAATAGATACACTGG - Intronic
1057413908 9:94844733-94844755 CAAATCCAAAATCTGTGCCCTGG + Intronic
1057548157 9:96033403-96033425 AAAATGCAAAAAATTTAGCCAGG - Intergenic
1057660992 9:97002855-97002877 CAAAGTCAAAATAGATACACTGG + Intronic
1058516861 9:105784817-105784839 CAAATGCTAAAAAACTACCCTGG - Intergenic
1059243344 9:112827396-112827418 CAAAGTCAAAAGATAAACCCAGG + Intronic
1059544293 9:115160775-115160797 CAAGTGCAAAACATCTCCCCAGG - Intronic
1060497989 9:124132002-124132024 CAGATGCAAACTATCTCCCCTGG - Intergenic
1185508939 X:648383-648405 AAAATGCAAAAAAATTACCCAGG - Intronic
1185666582 X:1770002-1770024 CAGATGCAAACTATATCGCCAGG + Intergenic
1187479247 X:19639856-19639878 CAGCTTCATAATATATACCCAGG - Intronic
1187499584 X:19828621-19828643 AAAATACAAAATAATTACCCAGG + Intronic
1187535389 X:20137283-20137305 AAAATACAAAAAAAATACCCAGG + Intronic
1189515494 X:41710067-41710089 CACACACAAAATCTATACCCTGG - Intronic
1189628990 X:42931785-42931807 CAAATCCAAATTATATCACCCGG + Intergenic
1191767365 X:64712726-64712748 CAAATGTAAAATATGGACACAGG - Intergenic
1191862390 X:65676594-65676616 CACTTCCCAAATATATACCCAGG - Intronic
1192323827 X:70115123-70115145 CAAATACAAAACAAATAGCCAGG + Intergenic
1193087800 X:77463047-77463069 CCACTGCTAGATATATACCCAGG - Intergenic
1196229502 X:113204624-113204646 CAAATAAAAAATAAATACCAAGG - Intergenic
1197532806 X:127651162-127651184 CAAATGCATAATATTTACAGAGG + Intergenic
1197885287 X:131211424-131211446 AAAATACAAAAAATTTACCCGGG - Intergenic
1198882189 X:141293638-141293660 AAAATGCAAAAAAAATAGCCCGG + Intergenic
1199133556 X:144224111-144224133 CAAAGGCAAAATATACTTCCAGG - Intergenic
1200373735 X:155757126-155757148 AAAATGCAAAATATTTAACATGG + Intergenic